ITGB1BP3 (NMRK2) (NM_001289117) Human Untagged Clone

CAT#: SC334688

NMRK2 (untagged) - Human nicotinamide riboside kinase 2 (NMRK2), transcript variant 1


  "NM_001289117" in other vectors (1)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "NMRK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NMRK2
Synonyms ITGB1BP3; MIBP; NRK2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001289117, the custom clone sequence may differ by one or more nucleotides


ATGAAGCTCATCGTGGGCATCGGAGGCATGACCAACGGCGGCAAGACCACGCTGACCAACAGCCTGCTCA
GAGCCCTGCCCAACTGCTGCGTGATCCATCAGGATGACTTCTTCAAGGCTCCTCTGTTTCAGCCCCAAGA
CCAAATAGCAGTTGGGGAAGACGGCTTCAAACAGTGGGACGTGCTGGAGTCTCTGGACATGGAGGCCATG
CTGGACACCGTGCAGGCCTGGCTGAGCAGCCCGCAGAAGTTTGCCCGTGCCCACGGGGTCAGCGTCCAGC
CAGAGGCCTCGGACACCCACATCCTCCTCCTGGAAGGCTTCCTGCTCTACAGCTACAAGCCCCTGGTGGA
CTTGTACAGCCGCCGGTACTTCCTGACCGTCCCGTATGAAGAGTGCAAGTGGAGGAGAAGTACCCGCAAC
TACACAGTCCCTGATCCCCCCGGCCTCTTCGATGGCCACGTGTGGCCCATGTACCAGAAGTATAGGCAGG
AGATGGAGGCCAACGGTGTGGAAGTGGTCTACCTGGACGGCATGAAGTCCCGAGAGGAGCTCTTCCGTGA
AGTCCTGGAAGACATTCAGAACTCGCTGCTGAACCGCTCCCAGGAATCAGCCCCCTCCCCGGCTCGCCCA
GCCAGGACACAGGGACCCGGACGCGGATGCGGCCACAGAACGGCCAGGCCTGCAGCGTCCCAGCAGGACA
GCATGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001289117
ORF Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001289117.1, NP_001276046.1
RefSeq Size 1157
RefSeq ORF 708
Locus ID 27231
Gene Summary Catalyzes the phosphorylation of nicotinamide riboside (NR) and nicotinic acid riboside (NaR) to form nicotinamide mononucleotide (NMN) and nicotinic acid mononucleotide (NaMN). Reduces laminin matrix deposition and cell adhesion to laminin, but not to fibronectin. Involved in the regulation of PXN at the protein level and of PXN tyrosine phosphorylation. May play a role in the regulation of terminal myogenesis. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.