EIF4EL3 (EIF4E2) (NM_001282958) Human Untagged Clone

CAT#: SC334695

EIF4E2 (untagged) - Human eukaryotic translation initiation factor 4E family member 2 (EIF4E2), transcript variant 2


  "NM_001282958" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
EIF4E2 mouse monoclonal antibody, clone OTI1F11 (formerly 1F11)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "EIF4E2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EIF4E2
Synonyms 4E-LP; 4EHP; EIF4EL3; h4EHP; IF4e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334695 representing NM_001282958.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACAACAAGTTCGACGCTTTGAAAGATGATGACAGTGGGGACCATGATCAGAATGAAGAAAACAGC
ACACAGAAAGATGGTGAGAAGGAAAAAACGGAACGAGACAAGAATCAGAGCAGTAGCAAGAGAAAGGCT
GTTGTCCCTGGACCGGCAGAGCATCCCCTGCAGTACAACTACACTTTTTGGTACTCCAGGAGAACCCCC
GGCCGTCCCACGAGCTCACAGAGCTATGAACAGAATATCAAACAGATTGGCACCTTTGCCTCTGTGGAG
CAGTTCTGGAGGTTTTATAGCCACATGGTACGTCCTGGGGACCTGACAGGCCACAGTGACTTCCATCTC
TTCAAAGAAGGAATTAAACCCATGTGGGAGGATGATGCAAATAAAAATGGTGGCAAGTGGATTATTCGG
CTGCGGAAGGGCTTGGCCTCCCGTTGCTGGGAGAATCTCATTTTGGCCATGCTGGGGGAACAGTTCATG
GTTGGGGAGGAGATCTGTGGGGCTGTGGTGTCTGTCCGCTTTCAGGAAGACATTATTTCAATATGGAAT
AAGACTGCCAGTGACCAAGCAACCACAGCCCGAATCCGGGACACACTTCGGCGAGTGCTTAACCTACCT
CCCAACACCATTATGGAATACAAAACTCACACCGACAGCATCAAGGCCTGGGAGGAGTTTCATGGCCTG
GTGAACAGCAGCGGCCGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282958
Insert Size 711 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282958.1
RefSeq Size 3630 bp
RefSeq ORF 711 bp
Locus ID 9470
Cytogenetics 2q37.1
Protein Families Transcription Factors
Protein Pathways Insulin signaling pathway, mTOR signaling pathway
MW 27.2 kDa
Gene Summary Recognizes and binds the 7-methylguanosine-containing mRNA cap during an early step in the initiation (PubMed:9582349, PubMed:17368478, PubMed:25624349). Acts as a repressor of translation initiation (PubMed:22751931). In contrast to EIF4E, it is unable to bind eIF4G (EIF4G1, EIF4G2 or EIF4G3), suggesting that it acts by competing with EIF4E and block assembly of eIF4F at the cap (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains alternate 3' exon structure and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (B) has a distinct C-terminus and is shorter than isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.