ATP6V0E2 (NM_001289990) Human Untagged Clone

CAT#: SC334698

ATP6V0E2 (untagged) - Human ATPase, H+ transporting V0 subunit e2 (ATP6V0E2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP6V0E2
• Synonyms: ATP6V0E2L; C7orf32
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334698 representing NM_001289990.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCGCGTGCGCGGCCCGGCCCGGCTGATCGCTTCGGGTGCTCGACTCCTGTTGCGCATGCTCAGCGCG
  CTGCCCGGCTGGGGACCCGCGCACCTGCAGCGCCCGCTGCTCGGCCCTGCATCCTGCCTGGGCATCCTG
  CGCCCGGCCATGACGGCGCACTCATTCGCCCTCCCGGTCATCATCTTCACCACGTTCTGGGGCCTCGTC
  GGCATCGCCGGGCCCTGGTTCGTGCCGAAGGGACCCAACCGCGGAGTGATCATCACCATGCTGGTCGCC
  ACCGCCGTCTGCTGTTACCTCTTCTGGCTCATCGCCATCCTGGCGCAGCTGAACCCCCTGTTCGGGCCC
  CAGCTGAAGAATGAGACCATCTGGTGCCCAGCTCTCGGAATGACTGTGGCTCCACTGTCCCTGACAACC
  CCTTCGTCCGGACCCTCCCCCACACAACTATGTCTGGTCACCAGCTCCCTCCTGCTGGCACCCAGAGAC
  CCGGACCCGCAGGGCCTGCCTGGTTCCTGGAAGTCTTCCCAGTCTTCCCAGCCAGCCCGGGCCCTGGGG
  AGCCCTGGGCACAGCAGCGGCCGAGGGGATGTCCTGCTCCAATACCCGCACTGCTCTGGAGTTTGCCCT
  CTTTCCCAAGGAGATGCTGCTGGGGAGCTGGTATGGGTGGGGTCTTTCCCTTTACAGACGGGGCAGATG
  CCAGGACTCAGCCCATCCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001289990
• Insert Size: 711 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289990.1
• RefSeq Size: 2704 bp
• RefSeq ORF: 711 bp
• Locus ID: 155066
• UniProt ID: Q8NHE4
• Cytogenetics: 7q36.1
• Protein Pathways: Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
• MW: 24.7 kDa
• Gene Summary: Multisubunit vacuolar-type proton pumps, or H(+)-ATPases, acidify various intracellular compartments, such as vacuoles, clathrin-coated and synaptic vesicles, endosomes, lysosomes, and chromaffin granules. H(+)-ATPases are also found in plasma membranes of specialized cells, where they play roles in urinary acidification, bone resorption, and sperm maturation. Multiple subunits form H(+)-ATPases, with proteins of the V1 class hydrolyzing ATP for energy to transport H+, and proteins of the V0 class forming an integral membrane domain through which H+ is transported. ATP6V0E2 encodes an isoform of the H(+)-ATPase V0 e subunit, an essential proton pump component (Blake-Palmer et al., 2007 [PubMed 17350184]).[supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (3) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded protein (isoform 3) has a longer and distinct C-terminus, compared to isoform 1.