RAB23 (NM_001278667) Human Untagged Clone

CAT#: SC334702

RAB23 (untagged) - Human RAB23, member RAS oncogene family (RAB23), transcript variant 4


  "NM_001278667" in other vectors (1)

Reconstitution Protocol

USD 341.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
RAB23 mouse monoclonal antibody,clone OTI2A8
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "RAB23"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB23
Synonyms HSPC137
Vector pCMV6-Entry
Sequence Data
>SC334702 representing NM_001278667.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTGGAGGAAGATATGGAAGTCGCCATAAAGATGGTGGTTGTAGGGAATGGAGCAGTTGGAAAATCA
AGTATGATTCAGCGATATTGCAAAGGCATTTTTACAAAAGACTACAAGAAAACCATTGGAGTTGATTTT
TTGGAGCGACAAATTCAAGTTAATGATGAAGATGTCAGACTAATGTTATGGGACACTGCAGGTCAGGAG
GAATTTGATGCAATTACAAAGGCCTACTATCGAGGAGCCCAGGCTTGTGTGCTCGTGTTCTCTACCACA
GATAGGGAATCTTTTGAAGCAGTTTCCAGTTGGAGAGAGAAAGTAGTAGCCGAAGTGGGAGATATACCA
ACTGTACTTGTGCAAAACAAGATTGATCTTCTGGATGATTCTTGTATAAAGAATGAGGAAGCTGAGGCA
CTGGCAAAAAGGTTAAAGTTAAGATTCTACAGAACATCAGTGAAAGAAGATCTAAATGTGAATGAAGTT
TTTAAGTATTTGGCTGAAAAATACCTTCAGAAACTCAAACAACAAATAGCTGAGGATCCAGAACTAACG
CATTCAAGTAGTAACAAGATTGGTGTCTTTAATACATCTGGTGGAAGTCACTCCGGTCAGAATTCAGGT
ACCCTCAATGGTGGAGATGTCATCAATCTTAGACCCAACAAACAAAGGACCAAGAAAAACAGAAATCCT
TTTAGCAGCTGTAGCATACCCTAA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278667
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278667.1
RefSeq Size 4540 bp
RefSeq ORF 714 bp
Locus ID 51715
UniProt ID Q9ULC3
Cytogenetics 6p12.1-p11.2
Protein Families Druggable Genome
Protein Pathways Hedgehog signaling pathway
MW 26.7 kDa
Gene Summary This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1-5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.