RFXANK (NM_001278728) Human Untagged Clone

CAT#: SC334704

RFXANK (untagged) - Human regulatory factor X-associated ankyrin-containing protein (RFXANK), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RFXANK
• Synonyms: ANKRA1; BLS; F14150_1; RFX-B
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334704 representing NM_001278728.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGAGCTTACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGAC
  CCTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTTTCCCTGCACC
  CCTGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGGCAGCTCCCTGAAGCACTCC
  ACCACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGCTCTGCCGGCCACCCTAGACTGTGACAAC
  CTCGTCAACAAGCCAGACGAGCGCGGCTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAG
  ACCGTTCGCTTCCTGCTGGAGTGGGGTGCCGACCCCCACATCCTGGCAAAAGAGCGAGAGAGCGCCCTG
  TCGCTGGCCAGCACAGGCGGCTACACAGACATTGTGGGGCTGCTGCTGGAGCGTGACGTGGACATCAAC
  ATCTATGATTGGAATGGAGGGACGCCACTGCTGTACGCTGTGCGCGGGAACCACGTGAAATGCGTTGAG
  GCCTTGCTGGCCCGAGGCGCTGACCTCACCACCGAAGCCGACTCTGGCTACACCCCGATGGACCTTGCC
  GTGGCCCTGGGATACCGGAAAGTGCAACAGGTGATCGAGAACCACATCCTCAAGCTCTTCCAGAGCAAC
  CTGGTGCCCGCTGACCCTGAGTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278728
• Insert Size: 714 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278728.1
• RefSeq Size: 1224 bp
• RefSeq ORF: 714 bp
• Locus ID: 8625
• UniProt ID: O14593
• Cytogenetics: 19p13.11
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Antigen processing and presentation, Primary immunodeficiency
• MW: 25.6 kDa
• Gene Summary: Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (4) differs in the 5' UTR, and has an alternate splice site and lacks an in-frame exon in the coding region, as compared to variant 1. The resulting isoform (b) lacks an internal single aa and an internal segment, as compared to isoform a. Variants 2 and 4 encode the same isoform c.