DDB2 (NM_001300734) Human Untagged Clone

CAT#: SC334716

DDB2 (untagged) - Human damage-specific DNA binding protein 2, 48kDa (DDB2), transcript variant D1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DDB2
• Synonyms: DDBB; UV-DDB2; XPE
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334716 representing NM_001300734.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCTCCCAAGAAACGCCCAGAAACCCAGAAGACCTCCGAGATTGTATTACGCCCCAGGAACAAGAGG
  AGCAGGAGTCCCCTGGAGCTGGAGCCCGAGGCCAAGAAGCTCTGTGCGAAGGGCTCCGGTCCTAGCAGA
  AGATGTGACTCAGACTGCCTCTGGGTGGGGCTGGCTGGCCCACAGATCCTGCCACCATGCCGCAGCATC
  GTCAGGACCCTCCACCAGCATAAGCTGGGCAGAGCTTCCTGGCCATCTGTCCAGCAGGGGCTCCAGCAG
  TCCTTTTTGCACACTCTGGATTCTTACCGGATATTACAAAAGGCTGCCCCCTTTGACAGGAGGGCTACA
  TCCTTGGCGTGGCACCCAACTCACCCCAGCACCGTGGCTGTGGGTTCCAAAGGGGGAGATATCATGCTC
  TGGAATTTTGGCATCAAGGACAAACCCACCTTCATCAAAGGGGCAGCCTGGCATCCTCGCTACAACCTC
  ATTGTTGTGGGCCGATACCCAGATCCTAATTTCAAAAGTTGTACCCCTTATGAATTGAGGACGATCGAC
  GTGTTCGATGGAAACTCAGGGAAGATGATGTGTCAGCTCTATGACCCAGAATCTTCTGGCATCAGTTCG
  CTTAATGAATTCAATCCCATGGGGGACACGCTGGCCTCTGCAATGGGTTACCACATTCTCATCTGGAGC
  CAGGAGGAAGCCAGGACACGGAAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300734
• Insert Size: 717 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300734.1
• RefSeq Size: 1303 bp
• RefSeq ORF: 717 bp
• Locus ID: 1643
• UniProt ID: Q92466
• Cytogenetics: 11p11.2
• Protein Families: Druggable Genome
• Protein Pathways: Nucleotide excision repair, p53 signaling pathway, Ubiquitin mediated proteolysis
• MW: 26.7 kDa
• Gene Summary: This gene encodes a protein that is necessary for the repair of ultraviolet light-damaged DNA. This protein is the smaller subunit of a heterodimeric protein complex that participates in nucleotide excision repair, and this complex mediates the ubiquitylation of histones H3 and H4, which facilitates the cellular response to DNA damage. This subunit appears to be required for DNA binding. Mutations in this gene cause xeroderma pigmentosum complementation group E, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development, in some cases accompanied by neurological abnormalities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (D1) lacks four consecutive alternate exons compared to variant WT, without a reading frame change. The resulting isoform (D1) has the same N- and C-termini but is shorter compared to isoform WT.