GNB1 (NM_001282538) Human Untagged Clone

CAT#: SC334733

GNB1 (untagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 1 (GNB1), transcript variant 3


  "NM_001282538" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-GNB1 Antibody
    • 100 ul

USD 380.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "GNB1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNB1
Synonyms MDS; MRD42
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334733 representing NM_001282538.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCTGTGCATATGCCCCTTCTGGGAACTATGTGGCCTGCGGTGGCCTGGATAACATTTGCTCCATT
TACAATCTGAAAACTCGTGAGGGGAACGTGCGCGTGAGTCGTGAGCTGGCAGGACACACAGGTTACCTG
TCCTGCTGCCGATTCCTGGATGACAATCAGATCGTCACCAGCTCTGGAGACACCACGTGTGCCCTGTGG
GACATCGAGACCGGCCAGCAGACGACCACGTTTACCGGACACACTGGAGATGTCATGAGCCTTTCTCTT
GCTCCTGACACCAGACTGTTCGTCTCTGGTGCTTGTGATGCTTCAGCCAAACTCTGGGATGTGCGAGAA
GGCATGTGCCGGCAGACCTTCACTGGCCACGAGTCTGACATCAATGCCATTTGCTTCTTTCCAAATGGC
AATGCATTTGCCACTGGCTCAGACGACGCCACCTGCAGGCTGTTTGACCTTCGTGCTGACCAGGAGCTC
ATGACTTACTCCCATGACAACATCATCTGCGGGATCACCTCTGTCTCCTTCTCCAAGAGCGGGCGCCTC
CTCCTTGCTGGGTACGACGACTTCAACTGCAACGTCTGGGATGCACTCAAAGCCGACCGGGCAGGTGTC
TTGGCTGGGCATGACAACCGCGTCAGCTGCCTGGGCGTGACTGACGATGGCATGGCTGTGGCGACAGGG
TCCTGGGATAGCTTCCTCAAGATCTGGAACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282538
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282538.1
RefSeq Size 3054 bp
RefSeq ORF 723 bp
Locus ID 2782
UniProt ID P62873
Cytogenetics 1p36.33
Protein Pathways Chemokine signaling pathway, Taste transduction
MW 25.9 kDa
Gene Summary Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.