Hsp40 (DNAJB1) (NM_001300914) Human Untagged Clone

CAT#: SC334738

DNAJB1 (untagged) - Human DnaJ (Hsp40) homolog, subfamily B, member 1 (DNAJB1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNAJB1
• Synonyms: Hdj1; Hsp40; HSPF1; RSPH16B; Sis1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334738 representing NM_001300914.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAACGGGGAGGAA
  GGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCACCAACGTGAACTTT
  GGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAAGATCCCCCAGTCACCCACGACCTTCGA
  GTCTCCCTTGAAGAGATCTACAGCGGCTGTACCAAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCC
  GACGGAAAGAGCATTCGAAACGAAGACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGA
  ACCAAAATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGCTGATATCGTCTTTGTT
  TTAAAGGACAAGCCCCACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGGATCAGC
  CTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCCCCACTCTGGACGGCAGGACGATACCCGTCGTA
  TTCAAAGATGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAAGGCCTCCCCCTCCCCAAAACA
  CCCGAGAAACGTGGGGACCTCATTATTGAGTTTGAAGTGATCTTCCCCGAAAGGATTCCCCAGACATCA
  AGAACCGTACTTGAGCAGGTTCTTCCAATATAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300914
• Insert Size: 723 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300914.1
• RefSeq Size: 2270 bp
• RefSeq ORF: 723 bp
• Locus ID: 3337
• UniProt ID: P25685
• Cytogenetics: 19p13.12
• MW: 27 kDa
• Gene Summary: This gene encodes a member of the DnaJ or Hsp40 (heat shock protein 40 kD) family of proteins. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. The encoded protein is a molecular chaperone that stimulates the ATPase activity of Hsp70 heat-shock proteins in order to promote protein folding and prevent misfolded protein aggregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon, lacks a portion of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2).