NSL1 (NM_001297736) Human Untagged Clone

CAT#: SC334740

NSL1 (untagged) - Human NSL1, MIS12 kinetochore complex component (NSL1), transcript variant 3


  "NM_001297736" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
NSL1 mouse monoclonal antibody,clone OTI6F7
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "NSL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NSL1
Synonyms C1orf48; DC8; MIS14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334740 representing NM_001297736.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGGTCTCCTGAGTTGGTGGTCCTTGACCCTCCATGGGACAAGGAGCTCGCGGCTGGCACAGAG
AGCCAGGCCTTGGTCTCCGCCACTCCCCGAGAAGACTTTCGGGTGCGCTGCACCTCGAAGCGGGCTGTG
ACCGAAATGCTACAACTGTGCGGCCGCTTCGTGCAAAAGCTCGGGGACGCTCTGCCGGAGGAGATTCGG
GAGCCCGCTCTGCGAGATGCGCAGTGGACTTTTGAATCAGCTGTGCAAGAGAATATCAGCATTAATGGG
CAAGCATGGCAGGAAGCTTCAGATAATTGTTTTATGGATTCTGACATCAAAGTACTTGAAGATCAGTTT
GATGAAATCATAGTAGATATAGCCACAAAACGTAAGCAGTATCCCAGAAAGATCCTGGAATGTGTCATC
AAAACCATAAAAGCAAAACAAGAAATTCTGTCCTTGCCTGCATTAATTGAACAAGGAGAGGGATTTTCC
CAAGTTCTCAGGATGCAGCCTGTTATCCACCTCCAGAGGATTCACCAAGAAGTCTTTTCCAGTTGTCAT
AGGAAACCAGATGCTAAACCTGAGAACTTTATAACACAGATAGAAACCACACCAACAGAGACTGCTTCC
AGGAAAACCTCTGACATGGTACTGAAAAGAAAGCAAACTAAAGACTGCCCCCAGAGAAAATGGTATCCA
TTGCGGCCAAAGAAAATTAATCTTGATACATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001297736
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297736.1
RefSeq Size 13025 bp
RefSeq ORF 723 bp
Locus ID 25936
Cytogenetics 1q32.3
MW 27.5 kDa
Gene Summary This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (3) lacks two alternate exons, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.