FAM120B (NM_001286381) Human Untagged Clone

CAT#: SC334758

FAM120B (untagged) - Human family with sequence similarity 120B (FAM120B), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM120B
• Synonyms: CCPG; dJ894D12.1; KIAA1838; PGCC1; SAN1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334758 representing NM_001286381.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACCATTCCAGGGGGAACGCCTAGTTTGAAAATATTATGGCTGAACCAAGAGCCAGAAATACAGGTT
  CGGCGCTTGGACACACTCCTAGCCTGTTTCAATCTTTCCTCCTCAAGAGAAGAGCTGCAGGCTGTCGAA
  AGCCCATTTCAAGCTTTGTGCTGCCTCTTGATCTACCTCTTTGTCCAGGTGGACACGCTTTGCCTGGAG
  GATTTGCATGCGTTTATTGCGCAGGCCTTGTGCCTCCAAGGAAAATCCACCTCGCAGCTTGTAAATCTA
  CAGCCTGATTACATCAACCCCAGAGCCGTGCAGCTGGGCTCCCTTCTCGTCCGCGGCCTCACCACTCTG
  GTTTTAGTCAACAGCGCATGTGGCTTCCCCTGGAAGACGAGTGATTTCATGCCCTGGAATGTATTTGAC
  GGGAAGCTTTTTCATCAGAAGTACTTGCAATCTGAAAAGGGTTATGCTGTGGAGGTTCTTTTAGAACAA
  AATAGATCTCGGCTCACCAAATTCCACAACCTGAAGGCAGTCGTCTGCAAGGCCTGCATGAAGGAGAAC
  AGACGCATCACTGGCCGAGCCCACTGGGGCTCACACCACGCAGGGAGGTGGGGAAGACAGGGCTCCAGC
  TACCACAGGACGGGCTCTGGGTATAGCCGTTCCAGTCAGGGACAGCCGTGGAGAGACCAGGGACCAGGA
  AGCAGACAGTATGAGCATGACCAGTGGAGAAGGTACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286381
• Insert Size: 729 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286381.1
• RefSeq Size: 3275 bp
• RefSeq ORF: 729 bp
• Locus ID: 84498
• UniProt ID: Q96EK7
• Cytogenetics: 6q27
• MW: 27.6 kDa
• Gene Summary: Functions as a transactivator of PPARG and ESR1. Functions in adipogenesis through PPARG activation (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) contains an alternate 5' exon and lacks two additional exons in the 5' coding region, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (d) is shorter at the N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.