CTRP5 (C1QTNF5) (NM_001278431) Human Untagged Clone

CAT#: SC334766

C1QTNF5 (untagged) - Human C1q and tumor necrosis factor related protein 5 (C1QTNF5), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C1QTNF5
• Synonyms: CTRP5; MFRP
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334766 representing NM_001278431.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGAGGCCACTCCTCGTCCTGCTGCTCCTGGGCCTGGCGGCCGGCTCGCCCCCACTGGACGACAACAAG
  ATCCCCAGCCTCTGCCCGGGGCACCCCGGCCTTCCAGGCACGCCGGGCCACCATGGCAGCCAGGGCTTG
  CCGGGCCGCGATGGCCGCGACGGCCGCGACGGCGCGCCCGGGGCTCCGGGAGAGAAAGGCGAGGGCGGG
  AGGCCGGGACTGCCGGGACCTCGAGGGGACCCCGGGCCGCGAGGAGAGGCGGGACCCGCGGGGCCCACC
  GGGCCTGCCGGGGAGTGCTCGGTGCCTCCGCGATCCGCCTTCAGCGCCAAGCGCTCCGAGAGCCGGGTG
  CCTCCGCCGTCTGACGCACCCTTGCCCTTCGACCGCGTGCTGGTGAACGAGCAGGGACATTACGACGCC
  GTCACCGGCAAGTTCACCTGCCAGGTGCCTGGGGTCTACTACTTCGCCGTCCATGCCACCGTCTACCGG
  GCCAGCCTGCAGTTTGATCTGGTGAAGAATGGCGAATCCATTGCCTCTTTCTTCCAGTTTTTCGGGGGG
  TGGCCCAAGCCAGCCTCGCTCTCGGGGGGGGCCATGGTGAGGCTGGAGCCTGAGGACCAAGTGTGGGTG
  CAGGTGGGTGTGGGTGACTACATTGGCATCTATGCCAGCATCAAGACAGACAGCACCTTCTCCGGATTT
  CTGGTGTACTCCGACTGGCACAGCTCCCCAGTCTTTGCTTAG
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278431
• Insert Size: 732 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278431.1
• RefSeq Size: 1361 bp
• RefSeq ORF: 732 bp
• Locus ID: 114902
• UniProt ID: Q9BXJ0
• Cytogenetics: 11q23.3
• Protein Families: Secreted Protein
• MW: 25.3 kDa
• Gene Summary: This gene encodes a member of a family of proteins that function as components of basement membranes and may play a role in cell adhesion. Mutations in this gene have been associated with late-onset retinal degeneration. The protein may be encoded by either a bicistronic transcript including sequence from the upstream membrane frizzled-related protein gene (MFRP), or by a monocistronic transcript expressed from an internal promoter. [provided by RefSeq, Jun 2013]
  Transcript Variant: This variant (2) lacks multiple 5' exons and represents use of an internal promoter, compared to variant 1. This variant is a monocistronic transcript that only encodes the C1QTNF5 protein. Both variants 1 and 2 encode the same protein.