CDCA3 (NM_001297602) Human Untagged Clone

CAT#: SC334769

CDCA3 (untagged) - Human cell division cycle associated 3 (CDCA3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CDCA3
• Synonyms: GRCC8; TOME-1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334769 representing NM_001297602.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGCTCAGCCAAGAGCGTCCCAGTCACACCAGCGCGGCCTCCGCCGCACAACAAGCATCTGGCTCGA
  GTGGCGGACCCCCGTTCACCTAGTGCTGGCATCCTGCGCACTCCCATCCAGGTGGAGAGCTCTCCACAG
  CCAGGCCTACCAGCAGGGGAGCAACTGGAGGGTCTTAAACATGCCCAGGACTCAGATCCCCGCTCTCCT
  ACTCTTGGTATTGCACGGACACCTATGAAGACCAGCAGTGGAGAGCCTGTTCTGCCCCCAGAGGCACCT
  TTATCTTCTGAATTGGACTTGCCTCTGGGTACCCAGTTATCTGTTGAGGAACAGATGCCACCTTGGAAC
  CAGACTGAGTTCCCCTCCAAACAGGTGTTTTCCAAGGAGGAAGCAAGACAGCCCACAGAAACCCCTGTG
  GCCAGCCAGAGCTCCGACAAGCCCTCAAGGGACCCTGAGACTCCCAGATCTTCAGGTTCTATGCGCAAT
  AGATGGAAACCAAACAGCAGCAAGGTACTAGGGAGATCCCCCCTCACCATCCTGCAGGATGACAACTCC
  CCTGGCACCCTGACACTACGACAGGGTAAGCGGCCTTCACCCCTAAGTGAAAATGTTAGTGAACTAAAG
  GAAGGAGCCATTCTTGGAACTGGACGACTTCTGAAAACTGGAGGACGAGCATGGGAGCAAGGCCAGGAC
  CATGACAAGGAAAATCAGCACTTTCCCTTGGTGGAGAGCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001297602
• Insert Size: 732 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297602.1
• RefSeq Size: 1869 bp
• RefSeq ORF: 732 bp
• Locus ID: 83461
• Cytogenetics: 12p13.31
• MW: 26.3 kDa
• Gene Summary: F-box-like protein which is required for entry into mitosis. Acts by participating in E3 ligase complexes that mediate the ubiquitination and degradation of WEE1 kinase at G2/M phase (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.