ERCC8 (NM_001290285) Human Untagged Clone

CAT#: SC334770

ERCC8 (untagged) - Human excision repair cross-complementation group 8 (ERCC8), transcript variant 4


  "NM_001290285" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
ERCC8 mouse monoclonal antibody, clone OTI2G1 (formerly 2G1)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ERCC8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ERCC8
Synonyms CKN1; CSA; UVSS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334770 representing NM_001290285.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGATACAAATACATTACAATTGGTACTAGAGGACCCAAAGTACAACTTTGTGACTTGAAGTCTGGA
TCCTGTTCTCACATTCTACAGGGTCACAGACAAGAAATATTAGCAGTTTCCTGGTCTCCACGTTATGAC
TATATCTTGGCAACAGCAAGTGCTGACAGTAGAGTAAAATTATGGGATGTGAGAAGAGCATCAGGATGT
TTGATTACTCTTGATCAACATAATGGGAAAAAGTCACAAGCTGTTGAATCAGCAAACACTGCTCATAAT
GGGAAAGTTAATGGCTTATGTTTTACAAGTGATGGACTTCACCTCCTCACTGTTGGTACAGATAATCGA
ATGAGGCTCTGGAATAGTTCCAATGGAGAAAACACACTTGTGAACTATGGAAAAGTTTGTAATAACAGT
AAAAAAGGATTGAAATTCACTGTCTCCTGTGGCTGCAGTTCAGAATTTGTTTTTGTACCATATGGTAGC
ACCATTGCTGTTTATACAGTTTACTCAGGAGAACAGATAACTATGCTTAAGGGACATTATAAAACTGTT
GACTGCTGTGTATTTCAGTCAAATTTCCAGGAACTTTATAGTGGTAGCAGAGACTGCAACATTCTGGCT
TGGGTTCCATCCTTATATGAACCAGTTCCTGATGATGATGAGACTACAACAAAATCACAATTAAATCCG
GCCTTTGAAGATGCCTGGAGCAGCAGTGATGAAGAAGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001290285
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290285.1
RefSeq Size 1962 bp
RefSeq ORF 732 bp
Locus ID 1161
Cytogenetics 5q12.1
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Nucleotide excision repair, Ubiquitin mediated proteolysis
MW 26.8 kDa
Gene Summary This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (4) lacks an alternate internal exon and uses a downstream AUG start codon compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.