Neuronal membrane glycoprotein M6 a (GPM6A) (NM_001261447) Human Untagged Clone

CAT#: SC334773

GPM6A (untagged) - Human glycoprotein M6A (GPM6A), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GPM6A
• Synonyms: GPM6; M6A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334773 representing NM_001261447.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAAGTGAAAGGGGGCAGGGTGGGGGCCTCTGGGGAGGAGACCCACAGTGAAGGGGAGGAAAACGGG
  CTTCTCGCAGAGGAGGCAGGTGGAAAGAGGGAGGGGTCTGTGCGCCCGCAGAGTCGCCAGGCGCCCTGC
  GAGTTGTCTCCGCTGGGAGGGGCGAGGCTGTCACTTGCCAGGGCGCGAGGAGCCTCAGCGCGGCTTGGA
  GAACTTGGCCCCGCGCAGCGTCTGGTCACTCGCTCTCCTCTGGGGACTGCAGAGAAGCAGGACCTCGGG
  CCATGGTTCATTATGCTGACATATCTTTTCATGTTGGCCTGGCTGGGAGTCACGGCTTTCACCTCACTG
  CCAGTTTACATGTACTTCAATCTGTGGACCATCTGCCGGAACACCACATTAGTGGAGGGAGCAAATCTC
  TGCTTGGACCTTCGTCAGTTTGGAATTGTGACAATTGGAGAGGAAAAGAAAATTTGTACTGTCTCTGAG
  AATTTCTTGAGGATGTGCGAATCTACTGAGCTGAACATGACCTTCCACTTGTTTATTGTGGCACTTGCT
  GGAGCTGGGGCAGCAGTCATTGCTATGGTTCACTACCTTATGGTTCTGTCTGCCAACTGGGCCTATGTG
  AAAGACGCCTGCCGGATGCAGAAGTATGAAGACATCAAGTCGAAGGAAGAGCAAGAGCTTCATGACATC
  CACTCTACTCGCTCCAAAGAGCGGCTCAATGCATACACATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001261447
• Insert Size: 732 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001261447.1
• RefSeq Size: 2806 bp
• RefSeq ORF: 732 bp
• Locus ID: 2823
• Cytogenetics: 4q34.2
• Protein Families: Transmembrane
• MW: 26.9 kDa
• Gene Summary: Involved in neuronal differentiation, including differentiation and migration of neuronal stem cells. Plays a role in neuronal plasticity and is involved in neurite and filopodia outgrowth, filopodia motility and probably synapse formation. GPM6A-induced filopodia formation involves mitogen-activated protein kinase (MAPK) and Src signaling pathways. May be involved in neuronal NGF-dependent Ca(2+) influx. May be involved in regulation of endocytosis and intracellular trafficking of G-protein-coupled receptors (GPCRs); enhances internalization and recycling of mu-type opioid receptor.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks three consecutive internal exons and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus, compared to isoform 1.