FAM3A (NM_001282311) Human Untagged Clone

CAT#: SC334783

FAM3A (untagged) - Human family with sequence similarity 3, member A (FAM3A), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FAM3A
• Synonyms: 2.19; DLD; DXS560S; XAP-7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334783 representing NM_001282311.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATCGTGGTCAGCATCCTCCTGGGTGGGCCTGGCAGTGGCTTTCCTCGCATCCAGCAACTCTTCAC
  CAGCTGGAGTGCAGTGGTGCAATCTCGGTTCACTGCAACCTCTACCTCCTGGGTTCAAGCGATTCTAGT
  GCCCCAGCCTCCCGAGTAGCTGAGACTACAGGTCCAGAGAGCTCGGTGACTGCAGCGCCACGGGCCAGG
  AAGTACAAGTGTGGCCTGCCCCAGCCGTGTCCTGAGGAGCACCTGGCCTTCCGCGTGGTCAGCGGGGCC
  GCCAACGTCATTGGGCCCAAGATCTGCCTCGAGGACAAGATGCTGATGAGCAGCGTCAAGGACAACGTG
  GGCCGCGGGCTGAACATCGCCCTGGTGAACGGGGTCAGCGGCGAGCTCATCGAGGCCCGGGCCTTTGAC
  ATGTGGGCCGGAGATGTCAACGACCTGTTGAAGTTTATTCGGCCACTGCACGAAGGCACCCTGGTGTTC
  GTGGCATCCTACGACGACCCAGCCACCAAGATGAATGAAGAGACCAGAAAGCTCTTCAGTGAGCTGGGC
  AGCAGGAACGCCAAGGAGCTGGCCTTCCGGGACAGCTGGGTGTTTGTCGGGGCCAAGGGTGTGCAGAAC
  AAGAGCCCCTTTGAGCAGCACGTGAAGAACAGTAAGCACAGCAACAAGTACGAAGGCTGGCCCGAGGCG
  CTGGAGATGGAAGGCTGTATCCCGCGGAGAAGCACGGCCAGCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282311
• Insert Size: 735 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282311.1
• RefSeq Size: 1919 bp
• RefSeq ORF: 735 bp
• Locus ID: 60343
• UniProt ID: P98173
• Cytogenetics: Xq28
• Protein Families: Secreted Protein, Transmembrane
• MW: 26.7 kDa
• Gene Summary: This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (5) contains an alternate exon in its 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (4) has a longer and distinct N-terminus, compared to isoform 1.