MDFI (NM_001300806) Human Untagged Clone

CAT#: SC334795

MDFI (untagged) - Human MyoD family inhibitor (MDFI), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MDFI
• Synonyms: I-MF; I-mfa
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334795 representing NM_001300806.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGTACCAGGTGAGCGGCCAGCGCCCCTCTGGCTGCGACGCGCCCTATGGAGCCCCCAGCGCAGCCCCG
  GGCCCAGCCCAGACCCTATCCCTCCTTCCTGGGCTGGAGGTAGTAACAGGATCCACTCACCCTGCGGAG
  GCAGCACCAGAGGAGGGCTCCCTGGAGGAGGCGGCAACCCCCATGCCCCAAGGCAATGGCCCTGGCATC
  CCCCAGGGCCTGGACAGCACTGACCTCGACGTCCCCACAGAAGCTGTGACATGCCAGCCTCAGGGGAAC
  CCCTTGGGCTGCACCCCACTTCTGCCGAATGACTCTGGCCACCCCTCAGAGCTGGGCGGCACCAGACGG
  GCGGGGAATGGTGCCCTGGGTGGCCCCAAGGCCCACCGGAAGTTGCAGACACACCCATCTCTCGCCAGC
  CAGGGCAGCAAGAAGAGTAAGAGCAGCAGCAAATCCACCACCTCCCAGATCCCCCTCCAGGCACAGGAA
  GACTGCTGTGTCCACTGCATCCTGTCCTGCCTGTTCTGCGAGTTCCTGACGCTGTGCAACATCGTCCTG
  GACTGCGCCACCTGTGGCTCCTGCAGCTCGGAGGACTCGTGCCTCTGCTGCTGCTGCTGTGGCTCTGGC
  GAGTGTGCCGACTGCGACCTGCCCTGCGACCTGGACTGCGGCATCCTGGATGCCTGCTGCGAGTCCGCG
  GACTGCCTGGAGATCTGCATGGAGTGCTGTGGGCTCTGCTTCTCCTCCTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001300806
• Insert Size: 741 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300806.1
• RefSeq Size: 1720 bp
• RefSeq ORF: 741 bp
• Locus ID: 4188
• UniProt ID: Q99750
• Cytogenetics: 6p21.1
• Protein Families: Transcription Factors
• MW: 25 kDa
• Gene Summary: This protein is a transcription factor that negatively regulates other myogenic family proteins. Studies of the mouse homolog, I-mf, show that it interferes with myogenic factor function by masking nuclear localization signals and preventing DNA binding. Knockout mouse studies show defects in the formation of vertebrae and ribs that also involve cartilage formation in these structures. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. It encodes the longer isoform (1). Variants 1, 3, and 4 encode the same isoform (1).