RhoGDI (ARHGDIA) (NM_001301243) Human Untagged Clone

CAT#: SC334812

ARHGDIA (untagged) - Human Rho GDP dissociation inhibitor (GDI) alpha (ARHGDIA), transcript variant 7


  "NM_001301243" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
ARHGDIA (RhoGDI) mouse monoclonal antibody, clone OTI1F2 (formerly 1F2)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ARHGDIA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARHGDIA
Synonyms GDIA1; HEL-S-47e; NPHS8; RHOGDI; RHOGDI-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334812 representing NM_001301243.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGAGCAGGAGCCCACAGCCGAGCAGCTGGCCCAGATTGCAGCGGAGAACGAGGAGGATGAGCAC
TCGGTCAACTACAAGCCCCCGGCCCAGAAGAGCATCCAGGAGATCCAGGAGCTGGACAAGGACGACGAG
AGCCTGCGAAAGTACAAGGAGGCCCTGCTGGGCCGCGTGGCCGTTTCCGCAGACCCCAACGTCCCCAAC
GTCGTGGTGACTGGCCTGACCCTGGTGTGCAGCTCGGCCCCGGGCCCCCTGGAGCTGGACCTGACGGGT
GAGTGCCCTGCGGCCGCGGGGGTCCGGGCGGCCCCTGGTGGGGATCTCGGGAAGTGCAGCCAGGGGGCC
GCGCAGGGCTGGGGCTTCGCGCAGGGCTGCTGGGCAGTCATTGAGGGGGAGGTCCCCCCAACAGGCGAC
CTGGAGAGCTTCAAGAAGCAGTCGTTTGTGCTGAAGGAGGGTGTGGAGTACCGGATAAAAATCTCTTTC
CGGGTTAACCGAGAGATAGTGTCCGGCATGAAGTACATCCAGCATACGTACAGGAAAGGCGTCAAGATT
GACAAGACTGACTACATGGTAGGCAGCTATGGGCCCCGGGCCGAGGAGTACGAGTTCCTGACCCCCGTG
GAGGAGGCACCCAAGGGTATGCTGGCCCGGGGCAGCTACAGCATCAAGTCCCGCTTCACAGACGACGAC
AAGACCGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAGAAGGACTGGAAGGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001301243
Insert Size 750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301243.1
RefSeq Size 2055 bp
RefSeq ORF 750 bp
Locus ID 396
UniProt ID P52565
Cytogenetics 17q25.3
Protein Families Druggable Genome
Protein Pathways Neurotrophin signaling pathway
MW 27.5 kDa
Gene Summary This gene encodes a protein that plays a key role in the regulation of signaling through Rho GTPases. The encoded protein inhibits the disassociation of Rho family members from GDP (guanine diphosphate), thereby maintaining these factors in an inactive state. Activity of this protein is important in a variety of cellular processes, and expression of this gene may be altered in tumors. Mutations in this gene have been found in individuals with nephrotic syndrome, type 8. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (7) differs in the 5' UTR and contains an alternate segment in the central coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (e) is longer than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.