ADPRH (NM_001291950) Human Untagged Clone

CAT#: SC334819

ADPRH (untagged) - Human ADP-ribosylarginine hydrolase (ADPRH), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ADPRH
• Synonyms: ARH1; hARH1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334819 representing NM_001291950.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCAGCTGAAGCCGGGCAAGCCCAATGGCTGGAGGATTCCCTTCAACAGCCATGAGGGCGGCTGTGGG
  GCTGCCATGCGGGCCATGTGCATCGGTCTCAGGTTCCCACACCATAGCCAACTGGACACACTGATCCAA
  GTGAGCATCGAGAGTGGTCGGATGACCCACCACCACCCAACAGGCTACCTGGGGGCCCTTGCGTCTGCT
  CTTTTTACAGCCTATGCTGTGAATAGCAGACCACCCTTGCAGTGGGGAAAAGGACTGATGGAGCTGCTA
  CCAGAAGCTAAAAAGTACATTGTCCAATCAGGCTACTTTGTAGAGGAAAATCTTCAACACTGGTCCTAC
  TTCCAAACCAAATGGGAAAATTACCTAAAACTTAGAGGGATTTTGGATGGAGAATCAGCCCCTACCTTC
  CCTGAGTCTTTCGGTGTGAAGGAGAGGGATCAGTTCTACACCTCCCTGAGCTACTCTGGCTGGGGTGGC
  AGCAGTGGGCACGATGCCCCCATGATTGCCTACGATGCTGTTCTTGCTGCAGGAGACTCCTGGAAGGAG
  CTTGCCCACCGAGCCTTTTTCCATGGTGGAGACAGTGATTCTACAGCTGCCATTGCTGGCTGCTGGTGG
  GGAGTTATGTATGGTTTTAAAGGAGTGAGTCCCTCCAACTATGAGAAACTAGAATACAGAAACCGGCTG
  GAAGAGACAGCTAGGGCTTTATATTCTCTCGGGTCAAAAGAAGACACTGTAATTTCCCTTTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001291950
• Insert Size: 753 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291950.1
• RefSeq Size: 3284 bp
• RefSeq ORF: 753 bp
• Locus ID: 141
• UniProt ID: P54922
• Cytogenetics: 3q13.33
• MW: 27.8 kDa
• Gene Summary: The enzyme encoded by this gene catalyzes removal of mono-ADP-ribose from arginine residues of proteins in the ADP-ribosylation cycle. Unlike the rat and mouse enzymes that require DTT for maximal activity, the human enzyme is DTT-independent. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, May 2014]
  Transcript Variant: This variant (3) lacks two exons, differs in the 5' UTR, and initiates translation at a downstream start codon compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.