PCMT1 (NM_001252050) Human Untagged Clone

CAT#: SC334821

PCMT1 (untagged) - Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PCMT1
• Synonyms: PIMT
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334821 representing NM_001252050.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCCGGGAGCGCGCAGTGGCGGCAGCGGCGGCGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCG
  AGCGGGGCGGTGACGGTGTGGGAGGTGGTCTCACTCTTGGGAAAACTGCTGGGCACCGTCGTCGCGCTG
  AAGGTGGTTCTGTACCTGCTCCGAGTGTGCTTAGCGATGGCCTGGAAATCCGGCGGCGCCAGCCACTCG
  GAGCTAATCCACAATCTCCGCAAAAATGGAATCATCAAGACAGATAAAGTATTTGAAGTGATGCTGGCT
  ACAGACCGCTCCCACTATGCAAAATGTAACCCATACATGGATTCTCCACAATCAATAGGTTTCCAAGCA
  ACAATCAGTGCTCCACACATGGTTGGATGTACTGGAAAAGTCATAGGAATTGATCACATTAAAGAGCTA
  GTAGATGACTCAGTAAATAATGTCAGGAAGGACGATCCAACACTTCTGTCTTCAGGGAGAGTACAGCTT
  GTTGTGGGGGATGGAAGAATGGGATATGCTGAAGAAGCCCCTTATGATGCCATTCATGTGGGAGCTGCA
  GCCCCTGTTGTACCCCAGGCGCTAATAGATCAGTTAAAGCCCGGAGGAAGATTGATATTGCCTGTTGGT
  CCTGCAGGCGGAAACCAAATGTTGGAGCAGTATGACAAGCTACAAGATGGCAGCATCAAAATGAAGCCT
  CTGATGGGGGTGATATACGTGCCTTTAACAGATAAAGAAAAGCAGTGGTCCAGGTGGAAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001252050
• Insert Size: 753 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252050.1
• RefSeq Size: 1646 bp
• RefSeq ORF: 753 bp
• Locus ID: 5110
• Cytogenetics: 6q25.1
• Protein Families: Druggable Genome
• MW: 26.6 kDa
• Gene Summary: This gene encodes a member of the type II class of protein carboxyl methyltransferase enzymes. The encoded enzyme plays a role in protein repair by recognizing and converting D-aspartyl and L-isoaspartyl residues resulting from spontaneous deamidation back to the normal L-aspartyl form. The encoded protein may play a protective role in the pathogenesis of Alzheimer's disease, and single nucleotide polymorphisms in this gene have been associated with spina bifida and premature ovarian failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3) lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.