PCMT1 (NM_001252052) Human Untagged Clone

CAT#: SC334829

PCMT1 (untagged) - Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), transcript variant 5


  "NM_001252052" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
PCMT1 mouse monoclonal antibody,clone OTI2A9
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "PCMT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PCMT1
Synonyms PIMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334829 representing NM_001252052.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGGAGCGCGCAGTGGCGGCAGCGGCGGCGACGGCAGTAACAGCGGCAGCTACAGCGGGGACGCG
AGCGGGGCGGTGACGGTGTGGGAGGTGGTCTCACTCTTGGGAAAACTGCTGGGCACCGTCGTCGCGCTG
AAGGTGGTTCTGTACCTGCTCCGAGTGTGCTTAGCGATGGCCTGGAAATCCGGCGGCGCCAGCCACTCG
GAGCTAATCCACAATCTCCGCAAAAATGGAATCATCAAGACAGATAAAGTATTTGAAGTGATGCTGGCT
ACAGACCGCTCCCACTATGCAAAATGTAACCCATACATGGATTCTCCACAATCAATAGGTTTCCAAGCA
ACAATCAGTGCTCCACACATGGTTGGATGTACTGGAAAAGTCATAGGAATTGATCACATTAAAGAGCTA
GTAGATGACTCAGTAAATAATGTCAGGAAGGACGATCCAACACTTCTGTCTTCAGGGAGAGTACAGCTT
GTTGTGGGGGATGGAAGAATGGGATATGCTGAAGAAGCCCCTTATGATGCCATTCATGTGGGAGCTGCA
GCCCCTGTTGTACCCCAGGCGCTAATAGATCAGTTAAAGCCCGGAGGAAGATTGATATTGCCTGTTGGT
CCTGCAGGCGGAAACCAAATGTTGGAGCAGTATGACAAGCTACAAGATGGCAGCATCAAAATGAAGCCT
CTGATGGGGGTGATATACGTGCCTTTAACAGATAAAGAAAAGCAGTGGTCCAGGGATGAATTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001252052
Insert Size 756 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001252052.1
RefSeq Size 1599 bp
RefSeq ORF 756 bp
Locus ID 5110
Cytogenetics 6q25.1
Protein Families Druggable Genome
MW 26.7 kDa
Gene Summary This gene encodes a member of the type II class of protein carboxyl methyltransferase enzymes. The encoded enzyme plays a role in protein repair by recognizing and converting D-aspartyl and L-isoaspartyl residues resulting from spontaneous deamidation back to the normal L-aspartyl form. The encoded protein may play a protective role in the pathogenesis of Alzheimer's disease, and single nucleotide polymorphisms in this gene have been associated with spina bifida and premature ovarian failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (5) lacks an in-frame coding exon and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.