CD48 (NM_001256030) Human Untagged Clone

CAT#: SC334841

CD48 (untagged) - Human CD48 molecule (CD48), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CD48
• Synonyms: BCM1; BLAST; BLAST1; hCD48; mCD48; MEM-102; SLAMF2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334841 representing NM_001256030.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTGCTCCAGAGGTTGGGATTCGTGTCTGGCTCTGGAATTGCTACTGCTGCCTCTGTCACTCCTGGTG
  ACCAGCATTCAAGGTCACTTGGTACATATGACCGTGGTCTCCGGCAGCAACGTGACTCTGAACATCTCT
  GAGAGCCTGCCTGAGAACTACAAACAACTAACCTGGTTTTATACTTTCGACCAGAAGATTGTAGAATGG
  GATTCCAGAAAATCTAAGTACTTTGAATCCAAATTTAAAGGCAGGGTCAGACTTGATCCTCAGAGTGGC
  GCACTGTACATCTCTAAGGTCCAGAAAGAGGACAACAGCACCTACATCATGAGGGTGTTGAAAAAGACT
  GGGAATGAGCAAGAATGGAAGATCAAGCTGCAAGTGCTTGACCCTGTACCCAAGCCTGTCATCAAAATT
  GAGAAGATAGAAGACATGGATGACAACTGTTATCTGAAACTGTCATGTGTGATACCTGGCGAGTCTGTA
  AACTACACCTGGTATGGGGACAAAAGGCCCTTCCCAAAGGAGCTCCAGAACAGTGTGCTTGAAACCACC
  CTTATGCCACATAATTACTCCAGGTGTTATACTTGCCAAGTCAGCAATTCTGTGAGCAGCAAGAATGGC
  ACGGTCTGCCTCAGTCCACCCTGTACCCTGGGTAAGAAGGATCCCTGGGAGCTGAGGGGGGCACAGGGT
  AACTGGAGTTGTTTTGAACAAAGAAAGGCTGGGGGTCCTATTCAGCCTCCTTGCACAGTGTGGTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001256030
• Insert Size: 759 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256030.1
• RefSeq Size: 1537 bp
• RefSeq ORF: 759 bp
• Locus ID: 962
• Cytogenetics: 1q23.3
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Natural killer cell mediated cytotoxicity
• MW: 28.9 kDa
• Gene Summary: This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting protein (isoform 2) is longer and has a distinct C-terminus compared to isoform 1.