BPNT1 (NM_001286149) Human Untagged Clone

CAT#: SC334849

BPNT1 (untagged) - Human 3'(2'), 5'-bisphosphate nucleotidase 1 (BPNT1), transcript variant 2


  "NM_001286149" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Goat Polyclonal Antibody against BPNT1
    • 100 ug

USD 375.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "BPNT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BPNT1
Synonyms HEL20; PIP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334849 representing NM_001286149.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCATATGTTCTTCATTGGCCCGGAAATTCCCCAAACTCACAATTATAGGGGAAGAGGATCTGCCT
TCTGAGGAAGTGGATCAAGAGCTGATTGAAGACAGTCAGTGGGAAGAAATACTGAAGCAACCATGCCCA
TCGCAGTACAGTGCTATTAAAGAAGAAGATCTCGTGGTCTGGGTTGATCCTCTGGATGGAACCAAGGAA
TATACCGAAGGTCTTCTTGACAATGTAACAGTTCTTATTGGAATTGCTTATGAAGGAAAAGCCATAGCA
GGAGTTATTAACCAGCCATATTACAACTATGAGGCAGGACCAGATGCTGTGTTGGGGAGGACAATCTGG
GGAGTTTTAGGTTTAGGCGCCTTTGGGTTTCAGCTGAAAGAAGTCCCTGCTGGGAAACACATTATCACA
ACTACTCGATCCCATAGCAACAAGTTGGTTACTGACTGTGTTGCTGCTATGAACCCCGATGCTGTGCTG
CGAGTAGGAGGAGCAGGAAATAAGATTATTCAGCTGATTGAAGGCAAAGCCTCTGCTTATGTATTTGCA
AGTCCTGGTTGTAAGAAGTGGGATACTTGTGCTCCAGAAGTTATTTTACATGCTGTGGGAGGCAAGTTA
ACCGATATCCATGGGAATGTTCTTCAGTACCACAAGGATGTGAAGCATATGAACTCTGCAGGAGTCCTG
GCCACACTGAGGAATTATGACTACTATGCAAGCCGAGTTCCAGAATCTATTAAAAATGCACTTGTTCCT
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001286149
Insert Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286149.1
RefSeq Size 2337 bp
RefSeq ORF 762 bp
Locus ID 10380
UniProt ID O95861
Cytogenetics 1q41
Protein Pathways Sulfur metabolism
MW 27.5 kDa
Gene Summary BPNT1, also called bisphosphate 3-prime-nucleotidase, or BPntase, is a member of a magnesium-dependent phosphomonoesterase family. Lithium, a major drug used to treat manic depression, acts as an uncompetitive inhibitor of BPntase. The predicted human protein is 92% identical to mouse BPntase. BPntase's physiologic role in nucleotide metabolism may be regulated by inositol signaling pathways. The inhibition of human BPntase may account for lithium-induced nephrotoxicity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 4 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.