RAB3IP (NM_001278402) Human Untagged Clone

CAT#: SC334859

RAB3IP (untagged) - Human RAB3A interacting protein (RAB3IP), transcript variant B

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB3IP
• Synonyms: RABIN3; RABIN8
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC334859 representing NM_001278402.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGTGAGAGAAGCAAATATCAAGCAGGCAACAGCAGAAAAACAGCTAAAAGAAGCACAAGGAAAAATT
  GATGTACTTCAAGCTGAAGTAGCTGCATTGAAGACACTTGTATTGTCCAGTTCTCCAACATCACCTACG
  CAGGAGCCTTTGCCAGGTGGAAAGACACCTTTTAAAAAGGGGCATACAAGAAATAAAAGCACAAGCAGT
  GCTATGAGTGGCAGTCATCAGGACCTCAGTGTGATACAGCCAATTGTAAAAGACTGCAAAGAGGCTGAC
  TTATCCTTGTATAATGAATTCCGATTGTGGAAGGATGAGCCCACAATGGACAGGACGTGTCCTTTCTTA
  GACAAAATCTACCAGGAAGATATCTTTCCATGTTTAACATTCTCAAAAAGTGAGTTGGCTTCAGCTGTT
  CTGGAGGCTGTGGAAAACAATACTCTAAGCATTGAACCAGTGGGATTACAACCTATCCGGTTTGTGAAA
  GCTTCTGCAGTTGAATGCGGAGGACCAAAAAAATGTGCTCTCACTGGCCAGAGTAAGTCCTGTAAACAC
  AGAATTAAATTAGGGGACTCAAGCAACTATTATTATATTTCTCCTTTTTGCAGATACAGGATCACTTCT
  GTATGTAACTTTTTTACATACATTCGATACATTCAGCAGGGACTCGTGAAACAGCAGGATGTTGATCAG
  ATGTTTTGGGAGGTTATGCAGTTGAGAAAAGAGATGTCATTGGCAAAGCTGGGTTATTTCAAAGAGGAA
  CTCTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278402
• Insert Size: 765 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278402.1
• RefSeq Size: 8781 bp
• RefSeq ORF: 765 bp
• Locus ID: 117177
• UniProt ID: Q96QF0
• Cytogenetics: 12q15
• MW: 28.6 kDa
• Gene Summary: Guanine nucleotide exchange factor (GEF) which may activate RAB8A and RAB8B. Promotes the exchange of GDP to GTP, converting inactive GDP-bound Rab proteins into their active GTP-bound form. Mediates the release of GDP from RAB8A and RAB8B but not from RAB3A or RAB5. Modulates actin organization and promotes polarized transport of RAB8A-specific vesicles to the cell surface. Together with RAB11A, RAB8A, the exocyst complex, PARD3, PRKCI, ANXA2, CDC42 and DNMBP promotes transcytosis of PODXL to the apical membrane initiation sites (AMIS), apical surface formation and lumenogenesis.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (B) has multiple differences, which result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant alpha 2. The resulting isoform (A) has a shorter N-terminus, compared to isoform alpha 2. Variants A and B encode the same isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.