HSPC142 (BABAM1) (NM_001288757) Human Untagged Clone

CAT#: SC334861

BABAM1 (untagged) - Human BRISC and BRCA1 A complex member 1 (BABAM1), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BABAM1
• Synonyms: C19orf62; HSPC142; MERIT40; NBA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334861 representing NM_001288757.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAAGTGGCAGAGCCCAGCAGCCCCACTGAAGAGGAGGAGGAGGAAGAGGAGCACTCGGCAGAGCCT
  CGGCCCCGCACTCGCTCCAATCCTGAAGGGGCTGAGGACCGGGCAGTAGGGGCACAGGCCAGCGTGGGC
  AGCCGCAGCGAGGGTGAGGGTGAGGCCGCCAGTGCTGATGATGGGAGCCTCAACACTTCAGGAGCCGGC
  CCTAAGTCCTGGCAGGTGCCCCCGCCAGCCCCTGAGGTCCAAATTCGGACACCAAGGGTCAACTGTCCA
  GAGAAAGTGATTATCTGCCTGGACCTGTCAGAGGAAATGTCACTGCCAAAGCTGGAGTCGTTCAACGGC
  CAGCAGAAAACTGAGCTTCCGGTCACAGAGAACGTGCAGACGATTCCCCCGCCATATGTGGTCCGCACC
  ATCCTTGTCTACAGCCGTCCACCTTGCCAGCCCCAGTTCTCCTTGACGGAGCCCATGAAGAAAATGTTC
  CAGTGCCCATATTTCTTCTTTGACGTTGTTTACATCCACAATGGCACTGAGGAGAAGGAGGAGGAGATG
  AGTTGGAAGGATATGTTTGCCTTCATGGGCAGCCTGGATACCAAGGGTACCAGCTACAAGTATGAGGTG
  GCACTGGCTGGGCCAGCCCTGGAGTTGCACAACTGCATGGCGAAACTGTTGGCCCACCCCCTGCAGCGG
  CCTTGCCAGAGCCATGCTTCCTACAGCCTGCTGGAGGAGGAGGATGAAGCCATTGAGGTTGAGGCCACT
  GTCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001288757
• Insert Size: 765 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001288757.1
• RefSeq Size: 1280 bp
• RefSeq ORF: 765 bp
• Locus ID: 29086
• UniProt ID: Q9NWV8
• Cytogenetics: 19p13.11
• MW: 28.2 kDa
• Gene Summary: Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. In the BRCA1-A complex, it is required for the complex integrity and its localization at DSBs. Component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates (PubMed:24075985, PubMed:26195665). In these 2 complexes, it is probably required to maintain the stability of BABAM2 and help the 'Lys-63'-linked deubiquitinase activity mediated by BRCC3/BRCC36 component. The BRISC complex is required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1 (PubMed:26195665). Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression (PubMed:24075985). Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination (PubMed:24075985).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) lacks three consecutive exons in the coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.