LILRB4 (NM_001278430) Human Untagged Clone

CAT#: SC334862

LILRB4 (untagged) - Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 (LILRB4), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LILRB4
• Synonyms: CD85K; ILT-3; ILT3; LIR-5; LIR5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334862 representing NM_001278430.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGATCCCCACCTTCACGGCTCTGCTCTGCCTCGGGCTGAGTCTGGGCCCCAGGACCCACATGCAGGCA
  GGGCCCCTCCCCAAACCCACCCTCTGGGCTGAGCCAGGCTCTGTGATCAGCTGGGGGAACTCTGTGACC
  ATCTGGTGTCAGGGGACCCTGGAGGCTCGGGAGTACCGTCTGGATAAAGAGGAAAGCCCAGCACCCTGG
  GACAGACAGAACCCACTGGAGCCCAAGAACAAGGCCAGATTCTCCATCCCATCCATGACAGAGGACTAT
  GCAGGGAGATACCGCTGTTACTATCGCAGCCCTGTAGGCTGGTCACAGCCCAGTGACCCCCTGGAGCTG
  GTGATGACAGGAGCCTACAGTAAACCCACCCTTTCAGCCCTGCCGAGTCCTCTTGTGACCTCAGGAAAG
  AGCGTGACCCTGCTGTGTCAGTCACGGAGCCCAATGGACACTTTTCTTCTGATCAAGGAGCGGGCAGCC
  CATCCCCTACTGCATCTGAGATCAGAGCACGGAGCTCAGCAGCACCAGGCTGAATTCCCCATGAGTCCT
  GTGACCTCAGTGCACGGGGGGACCTACAGGTGCTTCAGCTCACACGGCTTCTCCCACTACCTGCTGTCA
  CACCCCAGTGACCCCCTGGAGCTCATAGTCTCAGGATCCTTGGAGGGTCCCAGGCCCTCACCCACAAGG
  TCCGTCTCAACAGCTGCAGGCCCTGAGGACCAGCCCCTCATGCCTACAGGGTCAGTCCCCCACAGTGGT
  GAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278430
• Insert Size: 765 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278430.3
• RefSeq Size: 999 bp
• RefSeq ORF: 765 bp
• Locus ID: 11006
• UniProt ID: Q8NHJ6
• Cytogenetics: 19q13.42
• Protein Families: Transmembrane
• MW: 27.8 kDa
• Gene Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (5) lacks several exons, and its 3'-terminal exon extends past a splice site that is used in variant 1. The encoded isoform (5) has a shorter and distinct C-terminus, compared to isoform 1. Isoform 5 lacks the transmembrane domain found in isoform 1 and is suspected to be soluble (PMID: 19658091).