SURF4 (NM_001280788) Human Untagged Clone

CAT#: SC334863

SURF4 (untagged) - Human surfeit 4 (SURF4), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SURF4
• Synonyms: ERV29
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334863 representing NM_001280788.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTCCTCCGTGTCACAAAGCAGTACCTGCCCCACGTGGCGCGCCTCTGTCTGATCAGCACCTTCCTG
  GAGGACGGCATCCGTATGTGGTTCCAGTGGAGCGAGCAGCGCGACTACATCGACACCACCTGGAACTGC
  GGCTACCTGCTGGCCTCGTCCTTCGTCTTCCTCAACTTGCTGGGACAGCTGACTGGCTGCGTCCTGGTG
  TTGAGCAGGAACTTCGTGCAGTACGCCTGCTTCGGGCTCTTTGGAATCATAGCTCTGCAGACGATTGCC
  TACAGCATTTTATGGGACTTGAAGTTTTTGATGAGGAACCTGGCCCTGGGAGGAGGCCTGTTGCTGCTC
  CTAGCAGAATCCCGTTCTGAAGGGAAGAGCATGTTTGCGGGCGTCCCCACCATGCGTGAGAGCTCCCCC
  AAACAGTACATGCAGCTCGGAGGCAGGGTCTTGCTGGTTCTGATGTTCATGACCCTCCTTCACTTTGAC
  GCCAGCTTCTTTTCTATTGTCCAGAACATCGTGGGCACAGCTCTGATGATTTTAGTGGCCATTGGTTTT
  AAAACCAAGCTGGCTGCTTTGACTCTTGTTGTGTGGCTCTTTGCCATCAACGTATATTTCAACGCCTTC
  TGGACCATTCCAGTCTACAAGCCCATGCATGACTTCCTGAAATACGACTTCTTCCAGACCATGTCGGTG
  ATTGGGGGCTTGCTCCTGGTGGTGGCCCTGGGCCCTGGGGGTGTCTCCATGGATGAGAAGAAGAAGGAG
  TGGTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001280788
• Insert Size: 765 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001280788.1
• RefSeq Size: 2923 bp
• RefSeq ORF: 765 bp
• Locus ID: 6836
• Cytogenetics: 9q34.2
• Protein Families: Transmembrane
• MW: 28.8 kDa
• Gene Summary: This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (2) contains an alternate 5'-most exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct and shorter N-terminus, compared to isoform 1.