RBKS (NM_001287580) Human Untagged Clone

CAT#: SC334864

RBKS (untagged) - Human ribokinase (RBKS), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RBKS
• Synonyms: RBSK; RK
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334864 representing NM_001287580.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGACGTCCATGGTGTGTAAGGTTGGCAAAGATTCTTTTGGCAATGATTATATAGAAAACTTAAAACAG
  AATGATATTTCTACAGAATTTACATATCAGACTAAAGATGCTGCTACAGGAACTGCTTCTATAATTGTC
  AATAATGAAGGCCAGAATATCATTGTCATAGTGGCTGGAGCAAATTTACTTTTGAATACGGAGGATCTG
  AGGGCAGCAGCCAATGTCATTAGCAGAGCCAAAGTCATGGTCTGCCAGCTCGAAATAACTCCAGCAACT
  TCTTTGGAAGCCCTAACAATGGCCCGCAGGAGTGGAGTGAAAACCTTGTTCAATCCAGCCCCTGCCATT
  GCTGACCTGGATCCCCAGTTCTACACCCTCTCAGATGTGTTCTGCTGCAATGAAAGTGAGGCTGAGATT
  TTAACTGGCCTCACGGTGGGCAGCGCTGCAGATGCTGGGGAGGCTGCATTAGTGCTCTTGAAAAGGGGC
  TGCCAGGTGGTAATCATTACCTTAGGGGCTGAAGGATGTGTGGTGCTGTCACAGACAGAACCTGAGCCA
  AAGCACATTCCCACAGAGAAAGTCAAGGCTGTGGATACCACGGGTGCTGGTGACAGCTTTGTGGGAGCT
  CTGGCCTTCTACCTGGCTTACTATCCAAATCTGTCCTTGGAAGACATGCTCAACAGATCCAATTTCATT
  GCAGCAGTCAGTGTCCAGGCTGCAGGAACACAGTCATCTTACCCTTACAAAAAAGACCTTCCGCTTACT
  CTGTTTTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001287580
• Insert Size: 768 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001287580.1
• RefSeq Size: 2395 bp
• RefSeq ORF: 768 bp
• Locus ID: 64080
• UniProt ID: Q9H477
• Cytogenetics: 2p23.2
• Protein Families: Druggable Genome
• Protein Pathways: Pentose phosphate pathway
• MW: 27.1 kDa
• Gene Summary: This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
  Transcript Variant: This variant (2) differs in its 5' UTR, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.