FAM190B (CCSER2) (NM_001284243) Human Untagged Clone

CAT#: SC334896

CCSER2 (untagged) - Human coiled-coil serine-rich protein 2 (CCSER2), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CCSER2
• Synonyms: bA486O22.1; FAM190B; Gcap14; KIAA1128
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334896 representing NM_001284243.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAACCGCTTTGACCGACCAGACAGAAATGTTCGGCAGCCTCAGGAAGGTTTTTGGAAAAGGCCACCC
  CAGAGGTGGAGTGGACAGGAGCATTACCACCTCAGCCACCCTGACCACTATCATCACCATGGAAAAAGT
  GACTTGAGCAGAGGCTCTCCCTATAGAGAATCTCCTTTGGGTCATTTTGAAAGCTATGGAGGGATGCCC
  TTTTTCCAGGCTCAGAAGATGTTTGTTGATGTACCAGAAAATACAGTGATACTGGATGAGATGACCCTT
  CGGCACATGGTTCAGGATTGCACTGCTGTAAAAACTCAGTTACTCAAACTGAAACGTCTCCTGCATCAG
  CATGATGGAAGTGGTTCATTGCATGATATTCAACTGTCATTGCCATCCAGTCCAGAACCAGAAGATGGT
  GATAAAGTATATAAGAATGAAGATTTATTAAATGAAATAAAACAACTTAAAGACGAAATAAAGAAAAAA
  GATGAAAAGATCCAACTATTAGAACTTCAGCTTGCAACTCAGCATATCTGCCACCAAAAATGTAAAGAG
  GAAAAATGCACTTATGCTGATAAATATACCCAAACACCCTGGAGACGAATTCCTGGTGGGTATTCTGCT
  CCCTCCTTCTCTCCTTGGCAGGGCTCCTTCCAGGGGATCCCACGGACTGTTCCACCGCACCGCAGACAG
  ACCTCAAGTACTACAGCCTTCCAGCAGCCTTCCCAGACCCACAGATCACACCCAGGGAAAACTAATAAA
  GCCACAACGTATCGAGGCCCGCAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001284243
• Insert Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001284243.1
• RefSeq Size: 5906 bp
• RefSeq ORF: 786 bp
• Locus ID: 54462
• UniProt ID: Q9H7U1
• Cytogenetics: 10q23.1
• Protein Families: Druggable Genome
• MW: 30.3 kDa
• Gene Summary: Microtubule-binding protein which might play a role in microtubule bundling.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at a downstream start codon, and contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.