IKZF3 (NM_001284514) Human Untagged Clone

CAT#: SC334902

IKZF3 (untagged) - Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 14


  "NM_001284514" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
IKZF3 mouse monoclonal antibody, clone OTI7E11 (formerly 7E11)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "IKZF3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IKZF3
Synonyms AIO; AIOLOS; ZNFN1A3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334902 representing NM_001284514.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAAGTGAAAGAGCTCTCGTACTGGACAGATTAGCAAGCAATGTGGCAAAACGAAAAAGCTCAATG
CCTCAGAAATTCATTGGTGAGAAGCGCCACTGCTTTGATGTCAACTATAATTCAAGTTACATGTATGAG
AAAGAGAGTGAGCTCATACAGACCCGCATGATGGACCAAGCCATCAATAACGCCATCAGCTATCTTGGC
GCCGAAGCCCTGCGCCCCTTGGTCCAGACACCGCCTGCTCCCACCTCGGAGATGGTTCCAGTTATCAGC
AGCATGTATCCCATAGCCCTCACCCGGGCTGAGATGTCAAACGGTGCCCCTCAAGAGCTGGAAAAGAAA
AGCATCCACCTTCCAGAGAAGAGCGTGCCTTCTGAGAGAGGCCTCTCTCCCAACAATAGTGGCCACGAC
TCCACGGACACTGACAGCAACCATGAAGAACGCCAGAATCACATCTATCAGCAAAATCACATGGTCCTG
TCTCGGGCCCGCAATGGGATGCCACTTCTGAAGGAGGTTCCCCGCTCTTACGAACTCCTCAAGCCCCCG
CCCATCTGCCCAAGAGACTCCGTCAAAGTGATCAACAAGGAAGGGGAGGTGATGGATGTGTATCGGTGT
GACCACTGCCGCGTCCTCTTCCTGGACTATGTGATGTTCACGATTCACATGGGCTGCCACGGCTTCCGT
GACCCTTTCGAGTGTAACATGTGTGGATATCGAAGCCATGATCGGTATGAGTTCTCGTCTCACATAGCC
AGAGGAGAACACAGAGCCCTGCTGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001284514
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001284514.1
RefSeq Size 9812 bp
RefSeq ORF 789 bp
Locus ID 22806
UniProt ID Q9UKT9
Cytogenetics 17q12-q21.1
MW 30 kDa
Gene Summary This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (14) uses an alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (14) with a shorter N-terminus, compared to isoform 1. Variants 14, 15, and 16 encode the same isoform (14). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.