SLC25A45 (NM_001278250) Human Untagged Clone

CAT#: SC334918

SLC25A45 (untagged) - Human solute carrier family 25, member 45 (SLC25A45), transcript variant 3


  "NM_001278250" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-SLC25A45 Antibody
    • 100 ul

USD 310.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "SLC25A45"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC25A45
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334918 representing NM_001278250.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGTGGAGGAATTTGTGGCTGGCTGGATCTCTGGCGCTCTGGGCTTGGTCCTGGGACACCCGTTT
GACACTGTAAAGCTCCTGGGCTTCTTCAAGGGAATGAGCTTCCCCATTGCCAGCATAGCTGTGGTCAAC
TCTGTCCTGTTTGGGGTCTATAGCAACACCCTGCTGGTGCTCACGGCCACCTCCCACCAGGAGCGGCGG
GCCCAGCCGCCCAGCTACATGCACATCTTCCTAGCGGGCTGCACCGGGGGGTTCCTGCAGGCCTACTGT
CTGGCTCCTTTTGACCTCATCAAAGTCCGGCTACAAAACCAGACAGAGCCAAGGGCCCAGCCAGGGAGC
CCCCCACCCCGGTACCAGGGGCCCGTGCACTGTGCAGCCTCCATCTTCCGGGAGGAGGGGCCCCGGGGG
CTGTTCCGAGGAGCCTGGGCCCTGACGCTGAGGGACACCCCCACGGTGGGGATCTACTTCATCACCTAT
GAAGGGCTCTGTCGCCAGTACACACCAGAAGGCCAGAATCCCAGCTCAGCCACGGTGCTGGTGGCAGGG
GGCTTTGCAGGCATTGCTTCCTGGGTGGCAGCCACGCCCTTAGACGTGATCAAGTCCCGGATGCAGATG
GATGGACTGAGACGCAGAGTGTACCAGGGGATGCTGGACTGCATGGTGAGCAGCATCCGGCAGGAAGGA
CTGGGAGTCTTCTTCCGGGGGGTCACCATCAACAGTGCCCGCGCCTTTCCCGTCAATGCTGTCACCTTC
CTCAGCTACGAATATCTCCTCCGCTGGTGGGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278250
Insert Size 795 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278250.2
RefSeq Size 2463 bp
RefSeq ORF 795 bp
Locus ID 283130
UniProt ID Q8N413
Cytogenetics 11q13.1
Protein Families Druggable Genome, Transmembrane
MW 29 kDa
Gene Summary SLC25A45 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) differs in the 5' UTR and also lacks an in-frame coding exon, compared to variant 1. The resulting isoform (c) lacks an internal segment, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.