BARD1 (NM_001282549) Human Untagged Clone

CAT#: SC334920

BARD1 (untagged) - Human BRCA1 associated RING domain 1 (BARD1), transcript variant 5


  "NM_001282549" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit polyclonal anti-BARD1 antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "BARD1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol BARD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334920 representing NM_001282549.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCGGATAATCGGCAGCCGAGGAACCGGCAGCCGAGGATCCGCTCCGGGAACGAGCCTCGTTCCGCG
CCCGCCATGGAACCGGATGGTCGCGGTGCCTGGGCCCACAGTCGCGCCGCGCTCGACCGCCTGGAGAAG
CTGCTGCGCTGCTCGCGTTGTACTAACATTCTGAGAGAGCCTGTGTGTTTAGGAGGATGTGAGCACATC
TTCTGTAGTAATTGTGTAAGTGACTGCATTGGAACTGGATGTCCAGTGTGTTACACCCCGGCCTGGATA
CAAGACTTGAAGATAAATAGACAACTGGACAGCATGATTCAACTTTGTAGTAAGCTTCGAAATTTGCTA
CATGACAATGAGCTGTCAGGGGTAAAAGCATGTCTACGAAGAAAAGTATGTGAACAGGAAGAAAAGTAT
GAAATTCCTGAAGGTCCACGCAGAAGCAGGCTCAACAGAGAACAGCTGTTGCCAAAGCTGTTTGATGGA
TGCTACTTCTATTTGTGGGGAACCTTCAAACACCATCCAAAGGACAACCTTATTAAGCTCGTCACTGCA
GGTGGGGGCCAGATCCTCAGTAGAAAGCCCAAGCCAGACAGTGACGTGACTCAGACCATCAATACAGTC
GCATACCATGCGAGACCCGATTCTGATCAGCGCTTCTGCACACAGTATATCATCTATGAAGATTTGTGT
AATTATCACCCAGAGAGGGTTCGGCAGGGCAAAGTCTGGAAGGCTCCTTCGAGCTGGTTTATAGACTGT
GTGATGTCCTTTGAGTTGCTTCCTCTTGACAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282549
Insert Size 795 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282549.1
RefSeq Size 3984 bp
RefSeq ORF 795 bp
Locus ID 580
Cytogenetics 2q35
Protein Families Druggable Genome
MW 30.4 kDa
Gene Summary This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (5) six consecutively exons in the coding region, compared to variant 1. The resulting isoform (5, also known as epsilon) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.