KIF6 (NM_001289024) Human Untagged Clone

CAT#: SC334922

KIF6 (untagged) - Human kinesin family member 6 (KIF6), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KIF6
• Synonyms: C6orf102; dJ137F1.4; dJ188D3.1; dJ1043E3.1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334922 representing NM_001289024.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGAGAGGAAATGTCATTAGGATGCCAGGAGGCTTTTGAAATCTTCAAGAGGGACCACGCTGACAGC
  GTTACCATCGATGACAACAAACAGATTCTGAAACAGAGATTTTCTGAAGCCAAGGCCCTGGGAGAAAGT
  ATAAATGAAGCAAGAAGTAAAATTGGTCACCTGAAGGAAGAAATCACCCAGCGGCATATACAGCAAGTA
  GCCCTAGGAATCTCGGAAAACATGGCCGTGCCTCTGATGCCAGACCAGCAGGAGGAGAAGCTGCGATCA
  CAACTGGAGGAAGAAAAGAGAAGGTATAAAACAATGTTCACTCGCCTGAAAGCCCTGAAGGTGGAGATC
  GAGCACTTGCAGCTGCTCATGGACAAAGCCAAGGTGAAGCTACAGAAAGAGTTTGAAGTCTGGTGGGCA
  GAGGAGGCCACCAACCTGCAGGTAAATTCTCCAGCAGTGAATTCACTCGATCACACGAAGCCATTTCTC
  CAGACATCTGACTCCCAGCATGAATGGTCCCAACTCCTCTCTAACAAAAGTTCTGGAGGCTGGGAAGTC
  CAAGATCAAGGCACTGGCAGATTCGATGTCTGTGATGTGAATGCCAGGAAAATCCTGCCCTCGCCTTGC
  CCCAGTCCACACAGCCAGAAACAGAGCAGCACCAGCACCCCACTGGAAGACAGCATCCCCAAGAGGCCA
  GTGTCGTCCATCCCTCTCACCGGAGACAGCCAGACGGACTCGGACATCATCGCCTTCATCAAGGCCAGA
  CAGAGCATTCTGCAGAAGCAATGTTTGGGAAGCAATTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001289024
• Insert Size: 798 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001289024.1
• RefSeq Size: 2445 bp
• RefSeq ORF: 798 bp
• Locus ID: 221458
• UniProt ID: Q6ZMV9
• Cytogenetics: 6p21.2
• Protein Families: Druggable Genome
• MW: 30.1 kDa
• Gene Summary: This gene encodes a member of a family of molecular motors which are involved in intracellular transport of protein complexes, membrane organelles, and messenger ribonucleic acid along microtubules. Kinesins function as homodimeric molecules with two N-terminal head domains that move along microtubules and two C-terminal tail domains that interact with the transported cargo, either directly or indirectly, through adapter molecules. This gene is ubiquitously expressed in coronary arteries and other vascular tissue. A naturally occurring mutation in this gene is associated with coronary heart disease. [provided by RefSeq, May 2017]
  Transcript Variant: This variant (4) contains an alternate 5' terminal exon and initiates translation at a downstrean start codon, compared to variant 1. It encodes isoform 4, which has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.