CAPNS1 (NM_001302632) Human Untagged Clone

CAT#: SC334943

CAPNS1 (untagged) - Human calpain, small subunit 1 (CAPNS1), transcript variant 3


  "NM_001302632" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Anti-CAPNS1 Rabbit Polyclonal Antibody
    • 100 ul

USD 345.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CAPNS1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CAPNS1
Synonyms CALPAIN4; CANP; CANPS; CAPN4; CDPS; CSS1
Vector pCMV6-Entry
Sequence Data
>SC334943 representing NM_001302632.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCCTGGTTAACTCGTTCTTGAAGGGCGGCGGCGGCGGCGGCGGGGGAGGCGGGGGCCTGGGTGGG
GGCCTGGGAAATGTGCTTGGAGGCCTGATCAGCGGGGCCGGGGGCGGCGGCGGCGGCGGCGGCGGCGGC
GGCGGTGGTGGAGGCGGCGGTGGCGGTGGAACGGCCATGCGCATCCTAGGCGGAGTCATCAGCGCCATC
AGCGAGGCGGCTGCGCAGTACAACCCGGAGCCCCCGCCCCCACGCACACATTACTCCAACATTGAGGCC
AACGAGAGTGAGGAGGTCCGGCAGTTCCGGAGACTCTTTGCCCAGCTGGCTGGAGATGACATGGAGGTC
AGCGCCACAGAACTCATGAACATTCTCAATAAGGTTGTGACACGACACCCTGATCTGAAGACTGATGGT
TTTGGCATTGACACATGTCGCAGCATGGTGGCCGTGATGGATAGCGACACCACAGGCAAGCTGGGCTTT
GAGGAATTCAAGTACTTGTGGAACAACATCAAAAGGTGGCAGGCCATATACAAACAGTTCGACACTGAC
CGATCAGGGACCATTTGCAGTAGTGAACTCCCAGGTGCCTTTGAGGCAGCAGGGTTCCACCTGAATGAG
CATCTCTATAACATGATCATCCGACGCTACTCAGATGAAAGTGGGAACATGGATTTTGACAACTTCATC
AGCTGCTTGGTCAGGCTGGACGCCATGTTCCGTGCCTTCAAATCTCTTGACAAAGATGGCACTGGACAA
ATCCAGGTGAACATCCAGGAGTGGCTGCAGCTGACTATGTATTCCTGA

Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001302632
Insert Size 807 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302632.1
RefSeq Size 1486 bp
RefSeq ORF 807 bp
Locus ID 826
UniProt ID P04632
Cytogenetics 19q13.12
Protein Families Druggable Genome, Protease
MW 28.3 kDa
Gene Summary This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.