ARA9 (AIP) (NM_001302959) Human Untagged Clone

CAT#: SC334958

AIP (untagged) - Human aryl hydrocarbon receptor interacting protein (AIP), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AIP
• Synonyms: ARA9; FKBP16; FKBP37; PITA1; SMTPHN; XAP-2; XAP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334958 representing NM_001302959.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGAGCTCATCATTGGCAAGAAGTTCAAGCTGCCTGTGTGGGAGACCATCGTGTGCACCATGCGAGAA
  GGGGAGATTGCCCAGTTCCTCTGTGACATCAAGCATGTGGTCCTGTACCCGCTGGTGGCCAAGAGTCTC
  CGCAACATCGCGGTGGGCAAGGACCCCCTGGAGGGCCAGCGGCACTGCTGCGGTGTTGCACAGATGCGT
  GAACACAGCTCCCTGGGCCATGCTGACCTGGACGCCCTGCAGCAGAACCCCCAGCCCCTCATCTTCCAC
  ATGGAGATGCTGAAGGTGGAGAGCCCTGGCACGTACCAGCAGGACCCATGGGCCATGACAGACGAAGAG
  AAGGCAAAGGCAGTGCCACTTATCCACCAGGAGGGCAACCGGTTGTACCGCGAGGGGCATGTGAAGGAG
  GCTGCTGCCAAGTACTACGATGCCATTGCCTGCCTCAAGAACCTGCAGATGAAGGAACAGCCTGGGTCC
  CCTGAATGGATCCAGCTGGACCAGCAGATCACGCCGCTGCTGCTCAACTACTGCCAGTGCAAGCTGGTG
  GTCGAGGAGTACTACGAGGTGCTGGACCACTGCTCTTCCATCCTCAACAAGTACGACGACAACGTCAAG
  GCCTACTTCAAGCGGGGCAAGGCCCACGCGGCCGTGTGGAATGCCCAGGAGGCCCAGGCTGACTTTGCC
  AAAGTGCTGGAGCTGGACCCAGCCCTGGCGCCTGTGGTGAGCCGAGAGCTGCGGGCCCTGGAGGCACGG
  ATCCGGCAGAAGGACGAAGAGGACAAAGCCCGGTTCCGGGGGATCTTCTCCCATTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001302959
• Insert Size: 816 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302959.1
• RefSeq Size: 1221 bp
• RefSeq ORF: 816 bp
• Locus ID: 9049
• UniProt ID: O00170
• Cytogenetics: 11q13.2
• Protein Families: Druggable Genome, Transcription Factors
• MW: 31 kDa
• Gene Summary: The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
  Transcript Variant: This variant (2) contains an alternate exon in place of the first exon in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.