ALDH3B1 (NM_001290059) Human Untagged Clone

CAT#: SC334965

ALDH3B1 (untagged) - Human aldehyde dehydrogenase 3 family, member B1 (ALDH3B1), transcript variant 5


  "NM_001290059" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
ALDH3B1 mouse monoclonal antibody,clone OTI2F6
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ALDH3B1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALDH3B1
Synonyms ALDH4; ALDH7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334965 representing NM_001290059.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTA
CCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCC
ATGACTGCTGCCGCCAAGCACCTGACACCTGTCACCCTGGAGCTGGGGGGCAAGAACCCTTGCTACGTG
GACGACAACTGCGACCCCCAGACCGTGGCCAACCGCGTGGCCTGGTTCCGCTACTTCAACGCCGGCCAG
ACCTGCGTGGCCCCCGACTACGTCCTATGCAGCCCTGAGATGCAGGAGAGGCTGCTGCCTGCCCTGCAG
AGCACCATCACCCGTTTCTATGGCGACGACCCCCAGAGCTCCCCAAACCTGGGCCGCATCATCAACCAG
AAACAGTTCCAGCGGCTGCGGGCATTGCTGGGCTGCGGCCGTGTGGCCATTGGGGGCCAGAGCGATGAG
AGCGATCGCTACATCGCCCCCACGGTGCTGGTGGATGTGCAGGAGATGGAGCCTGTGATGCAGGAGGAG
ATCTTCGGGCCCATCCTGCCCATCGTGAACGTGCAGAGCTTGGACGAGGCCATCGAGTTCATCAACCGG
CGGGAGAAGCCCCTGGCCCTGTACGCCTTCTCCAACAGCAGCCAGGTGGTCAAGCGGGTGCTGACCCAG
ACCAGCAGCGGGGGCTTCTGTGGGAACGACGGCTTCATGCACATGACCCTGGCCAGCCTGCCTTTTGGA
GGAGTGGGTGCCAGTGGGATGGGCCGGTACCATGGCAAGTTCTCCTTCGACACCTTCTCCCACCATCGC
GCCTGCCTCCTGCGCAGCCCGGGGATGGAGAAGCTCAACGCCCTCCGCTACCCGCCGCAATCGCCGCGC
CGCCTGAGGATGCTGCTGGTGGCCATGGAGGCCCAAGGCTGCAGCTGCACACTGCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites AscI-MluI      Plasmid Map     
ACCN NM_001290059
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290059.1
RefSeq Size 2774 bp
RefSeq ORF 819 bp
Locus ID 221
UniProt ID P43353
Cytogenetics 11q13.2
Protein Families Druggable Genome
Protein Pathways Drug metabolism - cytochrome P450, Glycolysis / Gluconeogenesis, Histidine metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Phenylalanine metabolism, Tyrosine metabolism
MW 30.1 kDa
Gene Summary This gene encodes a member of the aldehyde dehydrogenase protein family. Aldehyde dehydrogenases are a family of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The encoded protein is able to oxidize long-chain fatty aldehydes in vitro, and may play a role in protection from oxidative stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Transcript Variant: This variant (5) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (d) has a shorter N-terminus, compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.