TOMM40L (NM_001286373) Human Untagged Clone

CAT#: SC334977

TOMM40L (untagged) - Human translocase of outer mitochondrial membrane 40 homolog (yeast)-like (TOMM40L), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TOMM40L
• Synonyms: TOMM40B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334977 representing NM_001286373.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGGAACACATTGGGCCTGGCACCAATGGGGACTTTGCCCCGCCGGAGCCCCCGCCGAGAGGAACCC
  CTGCCCAACCCTGGGAGCTTCGATGAGCTGCACCGTCTATGCAAAGATGTATTCCCAGCACAGATGGAG
  GGAGTGAAGCTCGTTGTCAACAAGGTTCTGAGCAGCCATTTCCAGGTGGCGCACACTATACACATGAGT
  GCCCTGGGCTTGCCGGGATATCACCTCCATGCGGCCTATGCAGGGGATTGGCAGCTCAGTCCCACTGAG
  ACGCAGCAGGCCAAGTTCCTGACATGGCAGTTTGATGGCGAGTATCGGGGAGATGACTACACAGCCACT
  CTGACCCTAGGAAATCCTGACCTGATTGGGGAGTCGGTGATCATGGTTGCTCACTTCCTGCAGAGCCTC
  ACTCATCGGCTGGTGCTGGGAGGAGAGCTAGTTTATCACCGGCGGCCAGGCGAAGAGGGGGCCATCTTG
  ACACTGGCTGGGAAGTACTCGGCTGTACACTGGGTAGCTACATTGAATGTGGGATCAGGCGGGGCCCAT
  GCAAGTTACTACCACAGGGCAAATGAACAGGTTCAGGTTGGAGTGGAGTTTGAGGCAAACACAAGGCTA
  CAAGACACAACATTCTCCTTTGGTTACCACCTGACTCTGCCCCAGGCCAACATGGTATTTAGAGGCTTG
  GTGGATAGTAACTGGTGTGTAGGTGCTGTGCTGGAGAAGAAGATGCCCCCTCTGCCTGTCACCCTAGCC
  CTTGGAGCCTTCCTCAATCACTGGCGCAACAGATTCCATTGTGGCTTCAGCATCACTGTGGGCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286373
• Insert Size: 825 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286373.1
• RefSeq Size: 2825 bp
• RefSeq ORF: 825 bp
• Locus ID: 84134
• UniProt ID: Q969M1
• Cytogenetics: 1q23.3
• Protein Families: Druggable Genome, Ion Channels: Other
• Protein Pathways: Amyotrophic lateral sclerosis (ALS)
• MW: 30.3 kDa
• Gene Summary: Potential channel-forming protein implicated in import of protein precursors into mitochondria.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.