NRBF2 (NM_001282405) Human Untagged Clone

CAT#: SC335008

NRBF2 (untagged) - Human nuclear receptor binding factor 2 (NRBF2), transcript variant 2


  "NM_001282405" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
NRBF2 mouse monoclonal antibody, clone OTI1A2 (formerly 1A2)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "NRBF2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NRBF2
Synonyms COPR; COPR1; COPR2; NRBF-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335008 representing NM_001282405.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCCCCGGCGCCACTACTCCCCTTCCTAAGGCCGCCGCTTACCCCGGGGTCTATGGAAGTAATGGA
AGGACCCCTCAACCTGCATATCTTTCTGAAGCCATGAAGCTGACACAGTCAGAGCAGGCTCATCTTTCA
CTGGAATTGCAAAGGGATAGCCATATGAAACAGCTCCTCCTCATCCAAGAGAGATGGAAAAGGGCCCAG
CGTGAAGAAAGATTGAAAGCCCAGCAGAACACAGACAAGGATGCAGCTGCCCATCTTCAGACATCTCAC
AAACCCTCTGCAGAGGATGCAGAGGGCCAGAGTCCCCTTTCTCAGAAGTACAGCCCTTCCACAGAGAAA
TGCCTGCCTGAGATTCAGGGGATCTTTGACAGGGATCCAGACACACTACTTTATTTACTTCAGCAAAAG
AGTGAGCCAGCAGAGCCATGTATTGGAAGCAAAGCCCCAAAAGATGATAAAACAATTATAGAGGAGCAG
GCAACCAAAATTGCAGATTTGAAGAGGCATGTGGAATTCCTTGTGGCTGAGAATGAAAGATTAAGGAAA
GAAAATAAACAACTAAAGGCTGAAAAGGCCAGACTTCTAAAAGGTCCAATAGAAAAGGAGCTGGATGTA
GATGCTGATTTTGTAGAAACGTCAGAGTTATGGAGCTTGCCACCACATGCAGAAACTGCTACAGCCTCC
TCAACCTGGCAGAAGTTCGCAGCAAATACTGGGAAAGCCAAGGACATTCCAATCCCCAATCTTCCTCCC
TTGGATTTTCCATCTCCAGAACTTCCTCTTATGGAGCTCTCTGAGGATATTCTGAAAGGATTTATGAAT
AATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001282405
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282405.1
RefSeq Size 1830 bp
RefSeq ORF 834 bp
Locus ID 29982
UniProt ID Q96F24
Cytogenetics 10q21.3
Protein Families Druggable Genome
MW 31 kDa
Gene Summary May modulate transcriptional activation by target nuclear receptors. Can act as transcriptional activator (in vitro).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region which results in the use of an alternate AUG compared to variant 1. It encodes isoform 2 which is shorter and has a distinct N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.