RCBTB2 (NM_001286832) Human Untagged Clone

CAT#: SC335009

RCBTB2 (untagged) - Human regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 (RCBTB2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCBTB2
• Synonyms: CHC1L; RLG
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335009 representing NM_001286832.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCTGGGGTTACAACGGAAACGGGCAGCTTGGACTCGGCAACAGTGGCAACCAGCCAACCCCTTGCA
  GAGTGGCAGCTTTGCAAGGCATCCGTGTCCAGAGGGATTATCGAGATTGCAGCCTGTCACTCCACACAC
  ACGTCTGCGGCCAAGACGCAGGGTGGGCACGTGTACATGTGGGGCCAGTGCCGGGGTCAGTCCGTGATC
  CTCCCGCACCTCACCCACTTCTCCTGCACTGACGACGTGTTTGCCTGCTTTGCCACGCCCGCCGTCACG
  TGGCGCCTCCTCTCCGTGGAACCTGATGACCACCTCACAGTGGCTGAGTCACTGAAGAGGGAATTTGAC
  AACCCGGACACTGCAGACCTGAAGTTTCTAGTTGATGGAAAGTACATTTATGCACATAAAGTCCTTCTC
  AAGATTCGATGTGAGCATTTTCGTTCGTCATTGGAAGATAACGAGGATGATATTGTAGAAATGAGTGAA
  TTTTCATATCCTGTTTACCGGGCCTTCCTGGAATACCTATACACAGACAGCATCAGCCTTTCTCCTGAG
  GAGGCAGTAGGACTGCTAGACTTGGCTACATTTTATAGAGAAAATCGTTTGAAAAAGCTCTGCCAACAA
  ACTATCAAGCAAGGCATCTGCGAGGAGAATGCCATCGCTCTGCTCTCGGCTGCGGTGAAGTATGATGCA
  CAGGATTTAGAAGAATTCTGCTTCAGGTTTTGCATAAACCATCTGACTGTAGTAACACAAACATCAGGT
  TTTGCAGAAATGGACCATGATCTCCTGAAGAACTTTATCAGCAAAGCAAGCAGAGTTGGAGCCTTTAAA
  AATTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001286832
• Insert Size: 834 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286832.1
• RefSeq Size: 2658 bp
• RefSeq ORF: 834 bp
• Locus ID: 1102
• UniProt ID: O95199
• Cytogenetics: 13q14.2
• MW: 31 kDa
• Gene Summary: This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
  Transcript Variant: This variant (4) differs in the 5' UTR, contains multiple differences in the 5' coding region, and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1. Variants 4, 8, and 9 all encode the same isoform (4).