RPA34 (RPA2) (NM_001297558) Human Untagged Clone
CAT#: SC335015
RPA2 (untagged) - Human replication protein A2, 32kDa (RPA2), transcript variant 3
"NM_001297558" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RPA2 |
Synonyms | REPA2; RP-A p32; RP-A p34; RPA32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC335015 representing NM_001297558.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCAGAGGAGACAGGAACAAGCGTAGCATCCGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGG GGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAA TCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTTGAT GAAGTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATCAGACATGCAGAG AAGGCTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGG GTTGACACAGATGACACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGC CACCTGAGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAAT GAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCC TCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTC ATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCAAGACCT GAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCT GTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGAT GCAGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI Plasmid Map |
ACCN | NM_001297558 |
Insert Size | 837 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001297558.1 |
RefSeq Size | 1626 bp |
RefSeq ORF | 837 bp |
Locus ID | 6118 |
UniProt ID | P15927 |
Cytogenetics | 1p35.3 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | DNA replication, Homologous recombination, Mismatch repair, Nucleotide excision repair |
MW | 30.2 kDa |
Gene Summary | This gene encodes a subunit of the heterotrimeric Replication Protein A (RPA) complex, which binds to single-stranded DNA (ssDNA), forming a nucleoprotein complex that plays an important role in DNA metabolism, being involved in DNA replication, repair, recombination, telomere maintenance, and co-ordinating the cellular response to DNA damage through activation of the ataxia telangiectasia and Rad3-related protein (ATR) kinase. The RPA complex protects single-stranded DNA from nucleases, prevents formation of secondary structures that would interfere with repair, and co-ordinates the recruitment and departure of different genome maintenance factors. The heterotrimeric complex has two different modes of ssDNA binding, a low-affinity and high-affinity mode, determined by which oligonucleotide/oligosaccharide-binding (OB) domains of the complex are utilized, and differing in the length of DNA bound. This subunit contains a single OB domain that participates in high-affinity DNA binding and also contains a winged helix domain at its carboxy terminus, which interacts with many genome maintenance protein. Post-translational modifications of the RPA complex also plays a role in co-ordinating different damage response pathways. [provided by RefSeq, Sep 2017] Transcript Variant: This variant (3) uses an alternate splice site in the 5' region and initiates translation at an alternate upstream start codon, compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is longer than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237121 | RPA2 (myc-DDK-tagged) - Human replication protein A2, 32kDa (RPA2), transcript variant 3 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review