RANBP1 (NM_001278639) Human Untagged Clone

CAT#: SC335017

RANBP1 (untagged) - Human RAN binding protein 1 (RANBP1), transcript variant 1


  "NM_001278639" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
RANBP1 mouse monoclonal antibody,clone OTI8E1
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "RANBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RANBP1
Synonyms HTF9A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335017 representing NM_001278639.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGTCGGCCTTGGGCCGGGCCAGGCGCACACTGAGTGGGCGGCCTTTCCAGAGGGCACCATGCAAA
ACGCGCAGGGCCTTGTCCCTCTCTGCAGCGCTGCGGAATGTCACAAAGGCGCAGGGTGGTTGCCCAAAG
AGTTTGGTTTTGTGGGGCTGCAGACCAAAGCGGCCCAGGAAGCGCCGGACGTCGCTGAAGCTGGCGTGG
CGAGGCACGTTCTGCAGCTCCAGTTTAAAGATCTCAGAGGACACTCATGAGGACCATGATACTTCCACT
GAGAATACAGACGAGTCCAACCATGACCCTCAGTTTGAGCCAATAGTTTCTCTTCCTGAGCAAGAAATT
AAAACACTGGAAGAAGATGAAGAGGAACTTTTTAAAATGCGGGCAAAACTGTTCCGATTTGCCTCTGAG
AACGATCTCCCAGAATGGAAGGAGCGAGGCACTGGTGACGTCAAGCTCCTGAAGCACAAGGAGAAAGGG
GCCATCCGCCTCCTCATGCGGAGGGACAAGACCCTGAAGATCTGTGCCAACCACTACATCACGCCGATG
ATGGAGCTGAAGCCCAACGCAGGTAGCGACCGTGCCTGGGTCTGGAACACCCACGCTGACTTCGCCGAC
GAGTGCCCCAAGCCAGAGCTGCTGGCCATCCGCTTCCTGAATGCTGAGAATGCACAGAAATTCAAAACA
AAGTTTGAAGAATGCAGGAAAGAGATCGAAGAGAGAGAAAAGAAAGCAGGATCAGGCAAAAATGATCAT
GCCGAAAAAGTGGCGGAAAAGCTAGAAGCTCTCTCGGTGAAGGAGGAGACCAAGGAGGATGCTGAGGAG
AAGCAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001278639
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278639.1
RefSeq Size 1389 bp
RefSeq ORF 837 bp
Locus ID 5902
UniProt ID P43487
Cytogenetics 22q11.21
MW 31.9 kDa
Gene Summary This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.