PPP1R7 (NM_001282410) Human Untagged Clone

CAT#: SC335032

PPP1R7 (untagged) - Human protein phosphatase 1, regulatory subunit 7 (PPP1R7), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP1R7
• Synonyms: SDS22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335032 representing NM_001282410.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGCGGAACGCGGCGCGGGGCAGCAACAGTCGCAGGAGATGATGGAGGTTGACAGGCGGGTCGAG
  TCTGAAGAATCCGGCGATGAAGAAGGGAAGAAACACAGCAGTGGCATCGTGGCCGACCTCAGTGAACAG
  AGCCTGAAGGATGGGGAGGAGCGGGGGGAGGAGGACCCAGAAGAAGAACATGAGCTGCCTGTGGACATG
  GAAACCATCAACCTGGACAGAGATGCAGAGGATGTTGATTTGAATCACTATCGCATAGGGAAGATTGAA
  GGATTTGAGGTACTGAAGAAAGTGAAGACTCTCTGCCTCCGCCAAAATTTAATTAAATGCATTGAGAAT
  CTGGAGGAGCTACAGAGTCTTCGAGAGCTGGATCTTTACGACAACCAGATCAAGAAGATTGAGAATCTG
  GAGGCGCTAACAGAGCTGGAGATTCTAGATATTTCTTTTAATCTGCTGAGAAACATCGAAGGGGTTGAC
  AAGTTGACACGACTGAAAAAACTCTTCTTGGTCAACAATAAAATCAGTAAAATTGAGAACTTAAGCAAC
  TTACATCAACTACAGATGCTAGAGCTGGGATCTAACCGCATCCGGGCAATCGAAAATATCGACACCTTA
  ACCAACCTGGAGAGTTTGTTTTTGGGGAAAAACAAAATTACTAAACTTCAGAACCTGGATGCGCTCACC
  AACCTGACAGTCCTCAGTATGCAGAGCAACCGGCTGACCAAGATCGAGGGTCTGCAGAACCTGGTGAAC
  CTGCGGGAGCTGTACCTTAGCCACAATGGCATCGAGGTCATCGAGGGCCTGGAGAACAATGTGCAGGAC
  AGCCTCACGTACTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282410
• Insert Size: 843 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282410.1
• RefSeq Size: 1803 bp
• RefSeq ORF: 843 bp
• Locus ID: 5510
• UniProt ID: Q15435
• Cytogenetics: 2q37.3
• Protein Families: Druggable Genome, Phosphatase
• MW: 32.1 kDa
• Gene Summary: This gene encodes a protein subunit that regulates the activity of the serine/threonine phosphatase, protein phosphatase-1. The encoded protein is required for completion of the mitotic cycle and for targeting protein phosphatase-1 to mitotic kinetochores. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
  Transcript Variant: This variant (3) differs in the 3' structure resulting in a novel 3' coding region and 3' UTR compared to variant 1. The encoded protein (isoform 3, also known as sds22beta1) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.