EB3 (MAPRE3) (NM_001303050) Human Untagged Clone

CAT#: SC335038

MAPRE3 (untagged) - Human microtubule-associated protein, RP/EB family, member 3 (MAPRE3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAPRE3
• Synonyms: EB3; EBF3; EBF3-S; RP3
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC335038 representing NM_001303050.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCCGTCAATGTGTACTCCACATCTGTGACCAGTGAAAATCTGAGTCGCCATGATATGCTTGCATGG
  GTCAACGACTCCCTGCACCTCAACTATACCAAGATAGAACAGCTTTGTTCAGGGGCAGCCTACTGCCAG
  TTCATGGACATGCTCTTCCCCGGCTGTGTGCACTTGAGGAAAGTGAAGTTCCAGGCCAAACTAGAGCAC
  GAATACATCCACAACTTCAAGGTGCTGCAAGCAGCTTTCAAGAAGATGGGTGTTGACAAAATCATTCCT
  GTAGAGAAATTAGTGAAAGGAAAATTCCAAGATAATTTTGAGTTTATTCAGTGGTTTAAGAAATTCTTT
  GACGCAAACTATGATGGAAAGGATTACAACCCTCTGCTGGCGCGGCAGGGCCAGGACGTAGCGCCACCT
  CCTAACCCAGGTGATCAGATCTTCAACAAATCCAAGAAACTCATTGGCACAGCAGTTCCACAGAGGACG
  TCCCCCACAGGCCCAAAAAACATGCAGACCTCTGGCCGGCTGAGCAATGTGGCCCCCCCCTGCATTCTC
  CGGAAGAATCCTCCATCAGCCCGAAATGGCGGCCATGAGACTGATGCCCAAATTCTTGAACTCAACCAA
  CAGCTGGTGGACTTGAAGCTGACAGTGGATGGGCTGGAGAAGGAACGTGACTTCTACTTCAGCAAACTT
  CGTGACATCGAGCTCATCTGCCAGGAGCATGAAAGTGAAAACAGCCCTGTTATCTCAGGCATCATTGGC
  ATCCTCTATGCCACAGAGGAAGGATTCGCACCCCCTGAGGACGATGAGATTGAAGAGCATCAACAAGAA
  GACCAGGACGAGTACTGA
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303050
• Insert Size: 846 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303050.1
• RefSeq Size: 1965 bp
• RefSeq ORF: 846 bp
• Locus ID: 22924
• UniProt ID: Q9UPY8
• Cytogenetics: 2p23.3
• MW: 32 kDa
• Gene Summary: The protein encoded by this gene is a member of the RP/EB family of genes. The protein localizes to the cytoplasmic microtubule network and binds APCL, a homolog of the adenomatous polyposis coli tumor suppressor gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants encode the same protein.