G protein alpha 13 (GNA13) (NM_001282425) Human Untagged Clone

CAT#: SC335044

GNA13 (untagged) - Human guanine nucleotide binding protein (G protein), alpha 13 (GNA13), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNA13
• Synonyms: G13
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335044 representing NM_001282425.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAGGGTGCTGGTTGATGCTCGAGAGAAGCTTCATATTCCCTGGGGAGACAACTCAAACCAACAACAT
  GGAGATAAGATGATGTCGTTTGATACCCGGGCCCCCATGGCAGCCCAAGGAATGGTGGAAACAAGGGTT
  TTCTTACAATATCTTCCTGCTATAAGAGCATTATGGGCAGACAGCGGCATACAGAATGCCTATGACCGG
  CGTCGAGAATTTCAACTGGGTGAATCTGTAAAATATTTCCTGGATAACTTGGATAAACTTGGAGAACCA
  GATTATATTCCATCACAACAAGATATTCTGCTTGCCAGAAGACCCACCAAAGGCATCCATGAATACGAC
  TTTGAAATAAAAAATGTTCCTTTCAAAATGGTTGATGTAGGTGGTCAGAGATCAGAAAGGAAACGTTGG
  TTTGAATGTTTCGACAGTGTGACATCAATACTTTTCCTTGTTTCCTCAAGTGAATTTGACCAGGTGCTT
  ATGGAAGATCGACTGACCAATCGCCTTACAGAGTCTCTGAACATTTTTGAAACAATCGTCAATAACCGG
  GTTTTCAGCAATGTCTCCATAATTCTGTTCTTAAACAAGACAGACTTGCTTGAGGAGAAGGTGCAAATT
  GTGAGCATCAAAGACTATTTCCTAGAATTTGAAGGGGATCCCCACTGCTTAAGAGACGTCCAAAAATTC
  CTGGTGGAATGTTTCCGGAACAAACGCCGGGACCAGCAACAGAAGCCCTTATACCACCACTTCACCACT
  GCTATCAACACGGAGAACATCCGCCTTGTTTTCCGTGACGTGAAGGATACTATTCTGCATGACAACCTC
  AAGCAGCTTATGCTACAGTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282425
• Insert Size: 849 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282425.1
• RefSeq Size: 6016 bp
• RefSeq ORF: 849 bp
• Locus ID: 10672
• UniProt ID: Q14344
• Cytogenetics: 17q24.1
• Protein Families: Druggable Genome
• Protein Pathways: Long-term depression, Regulation of actin cytoskeleton, Vascular smooth muscle contraction
• MW: 33.3 kDa
• Gene Summary: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems (PubMed:15240885, PubMed:16787920, PubMed:16705036, PubMed:27084452). Activates effector molecule RhoA by binding and activating RhoGEFs (ARHGEF1/p115RhoGEF, ARHGEF11/PDZ-RhoGEF and ARHGEF12/LARG) (PubMed:15240885, PubMed:12515866). GNA13-dependent Rho signaling subsequently regulates transcription factor AP-1 (activating protein-1) (By similarity). Promotes tumor cell invasion and metastasis by activating RhoA/ROCK signaling pathway (PubMed:16787920, PubMed:16705036, PubMed:27084452). Inhibits CDH1-mediated cell adhesion in process independent from Rho activation (PubMed:11976333).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) uses an alternate 5' terminal exon which results in the use of a downstream AUG compared to variant 1. The encoded isoform (2) has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.