SMN1 (NM_001297715) Human Untagged Clone

CAT#: SC335049

SMN1 (untagged) - Human survival of motor neuron 1, telomeric (SMN1), transcript variant a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SMN1
• Synonyms: BCD541; GEMIN1; SMA; SMA1; SMA2; SMA3; SMA4; SMA@; SMN; SMNT; T-BCD541; TDRD16A
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC335049 representing NM_001297715.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  ATGGCGATGAGCAGCGGCGGCAGTGGTGGCGGCGTCCCGGAGCAGGAGGATTCCGTGCTGTTCCGGCGC
  GGCACAGGCCAGAGCGATGATTCTGACATTTGGGATGATACAGCACTGATAAAAGCATATGATAAAGCT
  GTGGCTTCATTTAAGCATGCTCTAAAGAATGGTGACATTTGTGAAACTTCGGGTAAACCAAAAACCACA
  CCTAAAAGAAAACCTGCTAAGAAGAATAAAAGCCAAAAGAAGAATACTGCAGCTTCCTTACAACAGTGG
  AAAGTTGGGGACAAATGTTCTGCCATTTGGTCAGAAGACGGTTGCATTTACCCAGCTACCATTGCTTCA
  ATTGATTTTAAGAGAGAAACCTGTGTTGTGGTTTACACTGGATATGGAAATAGAGAGGAGCAAAATCTG
  TCCGATCTACTTTCCCCAATCTGTGAAGTAGCTAATAATATAGAACAAAATGCTCAAGAGAATGAAAAT
  GAAAGCCAAGTTTCAACAGATGAAAGTGAGAACTCCAGGTCTCCTGGAAATAAATCAGATAACATCAAG
  CCCAAATCTGCTCCATGGAACTCTTTTCTCCCTCCACCACCCCCCATGCCAGGGCCAAGACTGGGACCA
  GGAAAGCCAGGTCTAAAATTCAATGGCCCACCACCGCCACCGCCACCACCACCACCCCACTTACTATCA
  TGCTGGCTGCCTCCATTTCCTTCTGGACCACCAATAATTCCCCCACCACCTCCCATATGTCCAGATTCT
  CTTGATGATGCTGATGCTTTGGGAAGTATGTTAATTTCATGGTACATGAGTGGCTATCATACTGGCTAT
  TATATGGAAATGCTGGCATAG
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001297715
• Insert Size: 849 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001297715.1
• RefSeq Size: 1571 bp
• RefSeq ORF: 849 bp
• Locus ID: 6606
• UniProt ID: Q16637
• Cytogenetics: 5q13.2
• Protein Families: Druggable Genome, Stem cell - Pluripotency
• MW: 30.5 kDa
• Gene Summary: This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (a) lacks the penultimate exon, which results in an alternate translation stop codon, compared to variant d. The resulting isoform (a) is shorter and has a distinct C-terminus, compared to isoform d. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.