OSCAR (NM_001282349) Human Untagged Clone

CAT#: SC335054

OSCAR (untagged) - Human osteoclast associated, immunoglobulin-like receptor (OSCAR), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OSCAR
• Synonyms: PIgR-3; PIGR3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335054 representing NM_001282349.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCCCTGGTGCTGATCCTCCAGCTGCTGACCCTCTGGCCTCTGTGTCACACAGACATCACTCCGTCT
  GTCCCCCCAGCTTCATACCACCCTAAGCCATGGCTGGGAGCTCAGCCGGCTACAGTTGTGACCCCTGGG
  GTCAACGTGACCTTGAGATGCCGGGCACCCCAACCCGCTTGGAGATTTGGACTTTTCAAGCCTGGAGAG
  ATCGCTCCCCTTCTCTTCCGGGATGTGTCCTCCGAGCTGGCAGAATTCTTTCTGGAGGAGGTGACTCCA
  GCCCAAGGGGGAAGTTACCGCTGCTGCTACCGAAGGCCAGACTGGGGGCCGGGTGTCTGGTCCCAGCCC
  AGCGATGTCCTGGAGCTGCTGGTGACAGAGGAGCTGCCGCGGCCGTCGCTGGTGGCGCTGCCCGGGCCG
  GTGGTGGGTCCTGGCGCCAACGTGAGCCTGCGCTGCGCGGGCCGCCTGCGGAACATGAGCTTCGTGCTG
  TACCGCGAGGGCGTGGCGGCCCCGCTGCAGTACCGCCACTCCGCGCAGCCCTGGGCCGACTTCACGCTG
  CTGGGCGCCCGCGCCCCCGGCACCTACAGCTGCTACTATCACACGCCCTCCGCGCCCTACGTGCTGTCG
  CAGCGCAGCGAGGTGCTGGTCATCAGCTGGGAAGGTGAGGGCCCTGAGGCCCGGCCCGCCTCCTCCGCC
  CCAGGAATGCAGGCCCCAGGACCTCCGCCCTCAGACCCAGGAGCCCAGGCCCCCAGCCTCTCCTCCTTC
  AGACCCAGGGGTCTAGTCCTGCAGCCCCTCCTCCCTCAGACCCAGGATTCCTGGGACCCAGCCCCTCCT
  CCCTCAGATCCAGGAGTCTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282349
• Insert Size: 849 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282349.1
• RefSeq Size: 2061 bp
• RefSeq ORF: 849 bp
• Locus ID: 126014
• UniProt ID: Q8IYS5
• Cytogenetics: 19q13.42
• Protein Families: Druggable Genome
• MW: 30.5 kDa
• Gene Summary: Osteoclasts are multinucleated cells that resorb bone and are essential for bone homeostasis. This gene encodes an osteoclast-associated receptor (OSCAR), which is a member of the leukocyte receptor complex protein family that plays critical roles in the regulation of both innate and adaptive immune responses. The encoded protein may play a role in oxidative stress-mediated atherogenesis as well as monocyte adhesion. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (6) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (6) is shorter, compared to isoform 1.