DMC1 (NM_001278208) Human Untagged Clone

CAT#: SC335082

DMC1 (untagged) - Human DNA meiotic recombinase 1 (DMC1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DMC1
• Synonyms: dJ199H16.1; DMC1H; LIM15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335082 representing NM_001278208.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGAAGGAGGATCAAGTTGTGGCGGAAGAACCAGGATTCCAAGATGAAGAGGAATCTTTGTTTCAAGAT
  ATTGACCTGTTACAGAAACATGGAATTAACGTGGCTGACATTAAGAAACTGAAATCAGTAGGAATCTGT
  ACCATCAAAGGTATACAGATGACAACAAGAAGAGCTCTATGCAATGTCAAAGGACTCTCAGAAGCCAAA
  GTAGACAAGATTAAAGAGGCAGCGAACAAACTAATTGAACCAGGATTCTTGACTGCATTTGAGTATAGT
  GAAAAGAGGAAAATGGTTTTCCATATCACCACCGGGAGCCAGGAATTTGATAAGTTACTAGGAGGTGGA
  ATTGAAAGTATGGCAATTACAGAAGCTTTTGGAGAATTTCGTACTGGAAAAACCCAGCTTTCTCATACC
  CTCTGTGGTGAACATCAGATGGAGCTACTTGATTATGTAGCAGCAAAGTTCCATGAAGAAGCTGGCATC
  TTCAAGCTATTGATTATCGATTCAATAATGGCACTTTTTCGAGTGGATTTCAGTGGCCGTGGGGAGTTG
  GCCGAACGGCAGCAAAAATTGGCCCAGATGTTGTCACGACTCCAAAAAATCTCAGAAGAATATAACGTG
  GCTGTTTTTGTGACCAATCAAATGACTGCCGATCCAGGAGCAACTATGACCTTTCAGGCAGATCCCAAA
  AAACCCATTGGGGGACACATTCTGGCTCATGCTTCAACAACAAGAATAAGCTTGCGAAAGGGAAGAGGA
  GAGCTCAGAATTGCCAAGATTTATGACAGTCCTGAGATGCCTGAAAATGAAGCCACCTTCGCAATAACT
  GCTGGAGGAATTGGGGATGCCAAGGAGTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278208
• Insert Size: 858 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278208.1
• RefSeq Size: 2082 bp
• RefSeq ORF: 858 bp
• Locus ID: 11144
• UniProt ID: Q14565
• Cytogenetics: 22q13.1
• Protein Families: Druggable Genome
• MW: 31.6 kDa
• Gene Summary: This gene encodes a member of the superfamily of recombinases (also called DNA strand-exchange proteins). Recombinases are important for repairing double-strand DNA breaks during mitosis and meiosis. This protein, which is evolutionarily conserved, is reported to be essential for meiotic homologous recombination and may thus play an important role in generating diversity of genetic information. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR and lacks two alternate in-frame exons in the coding region compared to variant 1. The resulting protein (isoform 2) lacks an internal portion compared to isoform 1. Variants 2 and 4 encode the same protein.