PLAUR (NM_001301037) Human Untagged Clone

CAT#: SC335086

PLAUR (untagged) - Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLAUR
• Synonyms: CD87; U-PAR; UPAR; URKR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335086 representing NM_001301037.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAGCCTCTTGGGGCCTG
  CGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGTGCGCCCTGGGACAGGACCTCTGC
  AGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAGAGCTGGAGCTGGTGGAGAAAAGCTGTACCCAC
  TCAGAGAAGACCAACAGGACCCTGAGCTATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTG
  TGTGGGTTAGACTTGTGCAACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTC
  GAATGCATTTCCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGC
  AGCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGGGCGTCCAAAG
  GATGACCGCCACCTCCGTGGCTGTGGCTACCTTCCCGGCTGCCCGGGCTCCAATGGTTTCCACAACAAC
  GACACCTTCCACTTCCTGAAATGCTGCAACACCACCAAATGCAACGAGGGCCCAAAACCGAAAAACCAA
  AGCTATATGGTAAGAGGCTGTGCAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGC
  ATGAACCACATTGATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTCCAGTAC
  CGCAGTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACCCTGCTAATGACTGCC
  AGACTGTGGGGAGGCACTCTCCTCTGGACCTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001301037
• Insert Size: 861 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001301037.1
• RefSeq Size: 1427 bp
• RefSeq ORF: 861 bp
• Locus ID: 5329
• UniProt ID: Q03405
• Cytogenetics: 19q13.31
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Complement and coagulation cascades
• MW: 31.6 kDa
• Gene Summary: This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (4) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes isoform 4, which lacks an internal in-frame segment and is shorter, compared to isoform 1.