KIR2DS2 (NM_001291701) Human Untagged Clone

CAT#: SC335107

KIR2DS2 (untagged) - Human killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2DS2), transcript variant 5


  "NM_001291701" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-KIR2DS2 Antibody
    • 100 ug

USD 484.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "KIR2DS2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KIR2DS2
Synonyms 183ActI; CD158b; CD158J; cl-49; KIR-2DS2; KIR2DL1; NKAT-5; NKAT5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335107 representing NM_001291701.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGCTCATGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAG
GGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCCCCTGGTGAAATCAGAAGAGACAGTCATC
CTGCAATGTTGGTCAGATGTCAGGTTTGAGCACTTCCTTCTGCACAGAGAGGGGAAGTATAAGGACACT
TTGCACCTCATTGGAGAGCACCATGATGGGGTCTCCAAGGCCAACTTCTCCATCGGTCCCATGATGCAA
GACCTTGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCTCCCAGT
GACCCTCTGGACATCGTCATCACAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACG
GTTTTGGCAGGAGAGAGCGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCC
AGGGAGGGGGAGGCCCATGAACGTAGGTTCTCTGCAGGGCCCAAGGTCAACGGAACATTCCAGGCCGAC
TTTCCTCTGGGCCCTGCCACCCACGGAGGAACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCCTAT
GAGTGGTCAAACTCGAGTGACCCACTGCTTGTTTCTGTCACAGGTAACCCCAGACACCTGCATGTTCTG
ATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCC
AACAAAAAAAATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGATTCT
GATGAACAAGACCATCAGGAGGTGTCATACGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001291701
Insert Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291701.1
RefSeq Size 1522 bp
RefSeq ORF 864 bp
Locus ID 100132285
UniProt ID P43631
Cytogenetics 19q13.4
MW 31.7 kDa
Gene Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene represents a haplotype-specific family member that encodes a protein with a short cytoplasmic tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (5) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (e) that is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.