PPP2R2D (NM_001291310) Human Untagged Clone

CAT#: SC335113

PPP2R2D (untagged) - Human protein phosphatase 2, regulatory subunit B, delta (PPP2R2D), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP2R2D
• Synonyms: B55D; B55delta; MDS026
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335113 representing NM_001291310.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGATCTTATGGTAGAAGCGAGTCCACGGCGAATTTTTGCAAATGCTCACACATATCATATAAATTCC
  ATTTCAGTAAATAGTGATCATGAAACATATCTTTCTGCAGATGACCTGAGAATTAATTTATGGCACTTA
  GAAATCACAGATAGAAGCTTTAACATCGTGGACATCAAGCCTGCTAACATGGAGGAGCTGACCGAAGTC
  ATCACTGCAGCCGAGTTCCACCCGCACCAGTGCAACGTGTTCGTCTACAGCAGTAGCAAAGGGACCATC
  CGCCTGTGTGACATGCGCTCCTCGGCCCTGTGCGACAGACACTCCAAGTTTTTTGAAGAGCCTGAAGAT
  CCCAGCAGTAGGTCCTTCTTCTCAGAAATAATTTCATCCATATCCGATGTAAAATTCAGTCATAGTGGG
  CGGTACATGATGACCAGAGACTACCTGTCGGTGAAGGTGTGGGACCTCAACATGGAGAGCAGGCCGGTG
  GAGACCCACCAGGTCCACGAGTACCTGCGCAGCAAGCTCTGCTCTCTCTATGAGAACGACTGCATCTTT
  GACAAGTTTGAGTGTTGCTGGAACGGTTCGGATAGCGCCATCATGACCGGGTCCTATAACAACTTCTTC
  AGGATGTTTGATAGAGACACGCGGAGGGATGTGACCCTGGAGGCCTCGAGAGAGAGCAGCAAACCGCGC
  GCCAGCCTCAAACCCCGGAAGGTGTGTACGGGGGGTAAGCGGAGGAAAGACGAGATCAGTGTGGACAGT
  CTGGACTTCAACAAGAAGATCCTGCACACAGCCTGGCACCCCGTGGACAATGTCATTGCCGTGGCTGCC
  ACCAATAACTTGTACATATTCCAGGACAAAATCAACTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001291310
• Insert Size: 867 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001291310.1
• RefSeq Size: 6791 bp
• RefSeq ORF: 867 bp
• Locus ID: 55844
• UniProt ID: Q66LE6
• Cytogenetics: 10q26.3
• Protein Families: Druggable Genome, Phosphatase
• Protein Pathways: Tight junction
• MW: 33.4 kDa
• Gene Summary: B regulatory subunit of protein phosphatase 2A (PP2A) that plays a key role in cell cycle by controlling mitosis entry and exit. The activity of PP2A complexes containing PPP2R2D (PR55-delta) fluctuate during the cell cycle: the activity is high in interphase and low in mitosis. During mitosis, activity of PP2A is inhibited via interaction with phosphorylated ENSA and ARPP19 inhibitors. Within the PP2A complexes, the B regulatory subunits modulate substrate selectivity and catalytic activity, and also may direct the localization of the catalytic enzyme to a particular subcellular compartment (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (3) contains an additional exon in the 5' region, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a.