PRMT2 (NM_001286677) Human Untagged Clone

CAT#: SC335115

PRMT2 (untagged) - Human protein arginine methyltransferase 2 (PRMT2), transcript variant 7

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRMT2
• Synonyms: HRMT1L1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC335115 representing NM_001286677.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCAACATCAGGTGACTGTCCCAGAAGTGAATCGCAGGGAGAAGAGCCTGCTGAGTGCAGTGAGGCC
  GGTCTCCTGCAGGAGGGAGTACAGCCAGAGGAGTTTGTGGCCATCGCGGACTACGCTGCCACCGATGAG
  ACCCAGCTCAGTTTTTTGAGAGGAGAAAAAATTCTTATCCTGAGACAAACCACTGCAGATTGGTGGTGG
  GGTGAGCGTGCGGGCTGCTGTGGGTACATTCCGGCAAACCATGTGGGGAAGCACGTGGATGAGTACGAC
  CCCGAGGACACGTGGCAGGATGAAGAGTACTTCGGCAGCTATGGAACTCTGAAACTCCACTTGGAGATG
  TTGGCAGACCAGCCACGAACAACTAAATACCACAGTGTCATCCTGCAGAATAAAGAATCCCTGACGGAT
  AAAGTCATCCTGGACGTGGGCTGTGGGACTGGGATCATCAGTCTCTTCTGTGCACACTATGCGCGGCCT
  AGAGCGGTGTACGCGGTGGAGGCCAGTGAGATGGCACAGCACACGGGGCAGCTGGTCCTGCAGAACGGC
  TTTGCTGACATCATCACCGTGTACCAGCAGAAGGTGGAGGATGTGGTGCTGCCCGAGAAGGTGGACGTG
  CTGGTGTCTGAGTGGATGGGGACCTGCCTGCTGTTTGAGTTCATGATCGAGTCCATCCTGTATGCCCGG
  GATGCCTGGCTGAAGGAGGACGGGGTCATTTGGCCCACCATGGCTGCGTTGCACCTTGTGCCCTGCAGT
  GCTGATAAGGATTATCGTAGCAAGGTGCTCTTCTGGGACAACGCGTACGAGTTCAACCTCAGCGCTCTG
  AAGTTGGAGAAAAAGTCTTCCCCATCTGGAGATGACAGTTGA
  AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
  ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
  
• Restriction Sites: SgfI-RsrII Plasmid Map
• ACCN: NM_001286677
• Insert Size: 870 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001286677.1
• RefSeq Size: 1898 bp
• RefSeq ORF: 870 bp
• Locus ID: 3275
• UniProt ID: P55345
• Cytogenetics: 21q22.3
• Protein Families: Druggable Genome
• MW: 32.4 kDa
• Gene Summary: Arginine methyltransferase that methylates the guanidino nitrogens of arginyl residues in proteins such as STAT3, FBL, histone H4. Acts as a coactivator (with NCOA2) of the androgen receptor (AR)-mediated transactivation. Acts as a coactivator (with estrogen) of estrogen receptor (ER)-mediated transactivation. Enhances PGR, PPARG, RARA-mediated transactivation. May inhibit NF-kappa-B transcription and promote apoptosis. Represses E2F1 transcriptional activity (in a RB1-dependent manner). May be involved in growth regulation.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (7) differs in the 5' UTR and lacks 3 consecutive exons in the 3' coding region that causes a frame-shift compared to variant 1. The resulting shorter isoform (6) has a distinct C-terminus compared to isoform 1.